Entry information : Egl1CysPrx03-2
Entry ID 11045
Creation 2012-05-21 (Qiang Li)
Last sequence changes 2013-03-13 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-03-13 (Qiang Li)
Peroxidase information: Egl1CysPrx03-2
Name Egl1CysPrx03-2
Class 1-Cysteine peroxiredoxin    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Egl1CysPrx03-2
start..stop
S start..stop
Egu1CysPrx03 250 1e-86 1..137 40..220
Egr1CysPrx03 250 1e-86 1..137 40..220
Ecam1CysPrx03-2 250 2e-86 1..137 40..220
Ecam1CysPrx03-1 243 7e-84 1..134 40..217
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..47 47 N° 2 96..150 55 N° 3 510..653 144 N° 4 783..872 90
N° 5 954..1031 78  
join(1..47,96..150,510..653,783..872,954..1031)


exon

Literature and cross-references Egl1CysPrx03-2
Protein sequence: Egl1CysPrx03-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   137
PWM (Da):   %s   15025.77  
PI (pH):   %s   7.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GDFTPVCTTELGKMAAXDEVESHKAWIKDIEAFGAKVTYPIIADPNREIIKQLNMVEPEEKDASGKQVPSRALHIVGPDKKIKLSFLYPASTGRNMDEVVRVLESLQRATXEMFPQGYKTANLPSKKDYLRFTHVD*

Retrieve as FASTA  
Remarks Partial sequence from NGS. 5' end and PS are missing due to NNNNN in DNA.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGGATTTCACGCCGGTGTGCACGACGGAGCTCGGGAAGATGGCGGCGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACGAGGTCGAGTCGCACAAG
GCGTGGATCAAGGACATAGAGGCCTTCACC
GTCAGCTACTCTTCTCCCTATTAAACCTTTTTTTTATCACTTGGCACATATGTATATGTCTTGTAGGAACTTGCTTTTTGGGATTTCGAT
GTTGTGTTTTATCTGGTTATGGTGATAGTATCCTTCAGAAAGAAAAAGAAAGAGAACTTATAGGAATGTGTAGTATTATGATTTAGTAGAGTGACCAAGGGAAGTCTCCTTAATCTTAGG
CACAATTTGGGTAGAATGAGGTGGTTTAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGCTAAGGTGACGTACCCGATAATTGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCTGAGGAGAAAGACGCCT
CCGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATCGTCGGTCCTGATAAGAAG
GTATACGTGCTCCTCTTAACTTTTCTATTCCGTGTTAATTAAACTTTTATCGGATGAAACAAATTGC
ATAAACCAATGTCATCTCATGCATGTCGTTTTCGGTTTCACGATATAACATAAATTGTATAGATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGA
GGGTGCTGGAATCGCTGCAGAGGGCGACGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGAGATGT
TCCCGCAGGGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGGGATTTCACGCCGGTGTGCACGACGGAGCTCGGGAAGATGGCGGCNNGCGACGAGGTCGAGTCGCACAAGGCGTGGATCAAGGACATAGAGGCCTTCACCGGTGCTAAGGTGACGTAC
CCGATAATTGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCTGAGGAGAAAGACGCCTCCGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATCGTCGGTCCTGAT
AAGAAG
ATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTGGAATCGCTGCAGAGGGCGACGANNGAGATGTTCCCGCAGGGCTACAAG
ACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGATTAG

Retrieve as FASTA