Entry information : OsPrx95
Entry ID 1105
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-27 (Qiang Li)
Peroxidase information: OsPrx95
Name OsPrx95
Class Class III peroxidase    [Orthogroup: Prx061]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx95
start..stop
S start..stop
ObrPrx01 552 0 21..361 19..358
TaPrx11-1D 483 1e-172 25..359 23..362
AtaPrx11-1D 483 2e-172 25..359 23..362
TurPrx11-A 481 6e-172 25..359 23..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 258788..259201 414 N° 2 259297..259462 166 N° 3 260938..261443 506  
join(258788..259201,259297..259462,260938..261443)


exon

Literature and cross-references OsPrx95
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8L3W2
DNA ref. GenBank:   NC_008400.1 (258788..261440)
Protein sequence: OsPrx95
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (333)
PWM (Da):   %s   37405.07 (34610.6) Transmb domain:   %s   o10-32i296-318o338-360i (o310-332i)
PI (pH):   %s   5.89 (5.94) Peptide Signal:   %s   cut: 29 range:29-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAADHELRAAAVVMVVVVVLGMVSTSSAHVFVGAYNTTCPNAEDIVYKEMTSILAKSPELAGPVLRLFSVDCFVGGCEGSILLDSTPGNKAEKDSPLNKGVKGYEVVDAIKAKLDAACPGIVSCADTLALAARDVVRLTKGPYIPLPTGRRDGNSSNAADVAANSPAPGATVNDLLTIFAKFNFTAKDLAVLSGAHTIGKAHCSAFSTRLYSNSSSNGGPTLDANYTTALRGQCKVGDVDTLVDLDPPTPTTFDTDYYKQVAAQRGLLATDAALLLNADTKAYVLRQANATSDDEFFADFIVSFVNMSKIGVLTHSHGEIRHKCSAVNPPSPPSSAAASMLATSLAGSLLFLLAGVLVLLF

Retrieve as FASTA  
Remarks chromosome 7. 10 ESTs. Containing motif 'svdc'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGATCATGAATTGCGAGCTGCAGCAGTGGTGATGGTGGTGGTGGTGGTGCTGGGCATGGTGTCGACGTCGTCGGCGCACGTGTTCGTGGGGGCGTACAACACGACGTGCCCG
AACGCGGAGGACATCGTGTACAAGGAGATGACCAGCATCCTCGCCAAGTCGCCGGAGCTCGCCGGGCCGGTGCTGAGGCTCTTCTCCGTGGACTGCTTCGTGGGCGGCTGCGAGGGGTCC
ATCCTGCTGGACTCGACGCCGGGGAACAAGGCGGAGAAGGACTCGCCGCTGAACAAGGGAGTGAAAGGGTACGAGGTGGTGGACGCCATCAAGGCCAAGCTCGACGCCGCCTGCCCCGGC
ATCGTCTCCTGCGCCGACACCCTCGCCCTCGCCGCCCGCGACGTCGTGCGCCTG
GTAACTAACTAATCATTAGGATCGAGTTCTTGTACGTCATCATGATTCATGAACCAGCAGTAACTA
ATGCAAATATATATGCCATGCCTGAACAGACGAAAGGGCCGTACATCCCACTTCCGACAGGTCGGAGAGATGGCAACAGCTCTAACGCCGCCGATGTGGCCGCCAACTCTCCTGCCCCCG
GCGCCACCGTCAACGACCTCCTCACCATCTTCGCCAAGTTCAACTTCACCGCCAAGGATCTTGCCGTCCTCTCAG
GTACATACGCACACACTCTATACATATGTACGTTCCGTAATTTAG
TCCTATCAGATGTACTGTATGTTTAATTTACACTAAGGCGCTGTTCTATTCTTCAGCTTTCTTATTTTCCGTTAGCACGCTTTTTAATGGTGTGTTATTTTAAAAGTTTCTATATAGAAG
TTATTTAAAATAAATAAATAAATCCATTTTTTTTAATTTATAACAGTTAATACTTAGTTAATCATATGCTAATAATGTTTCTCGTTTTGCGTGCCATAAAAATCCATATGATTTTTATAA
TAACTTTTCAATATAACTTTTTTTAAAAAAACACGGCGTTTAGTAGTTTTGGAAGCGAGCGCGTGGAAAATGAGAGAGTAAAAGTTTGAAAAGGTAAAGAAAGTCCCATTTTATATATAT
AGTTGTCATCAACCTGTTGTACATACATTGTGTATGAGGTCATGTCGTTGTATGCATGGTAAAAGTGGGACTGTGAAGGAGAGAAGCTAGTGGTCGATCCTATTTATCTCAATTTCTAAA
TATAAGTATTCTTAGGACTTAAATTTATACACAATATAAGCATTTTGAAGACATTGATTATGAGAATCCCAGCATTTTTAACCAATCAGGTGTTTAGAAGGGAATCCAAGTAATTTAAAA
TTTAAAATTTAACCAACAAAGTGACAAATAAATAATGTTTCTCTTATCTTAATCTTTGCTAAATAACTTAGAAAGAATTTCTTATGTTTAGAAACAGAAGGAGAATCATACACCCTCTGT
TCTAAAAATATATATATATAATTCTTAGAAGTTAGTTTTTCTTGGGGCTAAGGGAGTATATACTCTAGGGAGTTTTCTTTTGGCTTCTCTACAAAGTGCTTCAGTATCTAAATTAAGCCG
GAGATTTAGTGGGTTGGACTCAATAAGAGTGCAATCTAAATAAGAAGTCTATTTTTATGTCAGCTCAATTGCGAGTCAAGTTTCAATCCCACCCCTCAATTACAAAACCGGATATATGTC
ATCTCTCAACTTTTAAAACTAGTGCAAATAAATCACTGAATAGAATAGTGAACAGTTTTGGCAACCGTGGCACTTTATATGGCACGTTGGCCTGATCTTTTAGGTGATGTGGCACAAGGT
AGCATTTTAGTTCGAAAGAGGCACGGAGGTGACACGCGCTCTTAATAATTTCAAGGTATTCAGTTTGCACTGGTTTTAGAAGTTGGGGATCCTCCAGACATGGACACATGGTTTTGCGGT
TGAGAGATGAAAAAGAAACTTGGACACCATAGCTGAGAGAGGTGAAATGAACTTTATTCGTTATGCACATGGTAGGCTTTCTATTGGGCCATTTCCCAAAATCCCAACCTCCACCTCACG
CAGCATGAATAGGACCTGCCTGTCCACCTCATAGCATGAATCTGACCCATTGAGACTAGTATGTAAATTAGGCCCATCATGACATTTGGGGTTGGGTTGGGCATTTGCAGGTGCGCACAC
GATCGGCAAGGCCCACTGCTCCGCCTTCTCCACCCGCCTCTACAGCAACTCCTCCTCCAACGGCGGCCCCACGCTGGACGCCAACTACACGACGGCGCTCCGCGGGCAGTGCAAGGTCGG
CGACGTGGACACCCTCGTCGACCTCGACCCCCCAACCCCGACCACCTTCGACACCGACTACTACAAGCAGGTGGCCGCGCAGCGGGGCCTCCTCGCCACCGACGCCGCGCTTCTCCTCAA
CGCCGACACCAAGGCCTACGTCCTCCGCCAGGCCAACGCCACCTCCGACGACGAGTTCTTCGCCGACTTCATCGTCTCCTTCGTCAACATGAGCAAGATCGGCGTGCTCACCCACTCCCA
CGGCGAGATCAGGCACAAGTGCTCTGCTGTCAACCCGCCGTCGCCGCCGTCCTCCGCCGCCGCCTCCATGCTCGCCACCTCGCTCGCCGGCTCGCTTCTCTTCCTCCTCGCGGGGGTCCT
CGTGCTGCTCTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGATCATGAATTGCGAGCTGCAGCAGTGGTGATGGTGGTGGTGGTGGTGCTGGGCATGGTGTCGACGTCGTCGGCGCACGTGTTCGTGGGGGCGTACAACACGACGTGCCCG
AACGCGGAGGACATCGTGTACAAGGAGATGACCAGCATCCTCGCCAAGTCGCCGGAGCTCGCCGGGCCGGTGCTGAGGCTCTTCTCCGTGGACTGCTTCGTGGGCGGCTGCGAGGGGTCC
ATCCTGCTGGACTCGACGCCGGGGAACAAGGCGGAGAAGGACTCGCCGCTGAACAAGGGAGTGAAAGGGTACGAGGTGGTGGACGCCATCAAGGCCAAGCTCGACGCCGCCTGCCCCGGC
ATCGTCTCCTGCGCCGACACCCTCGCCCTCGCCGCCCGCGACGTCGTGCGCCTG
ACGAAAGGGCCGTACATCCCACTTCCGACAGGTCGGAGAGATGGCAACAGCTCTAACGCCGCCGAT
GTGGCCGCCAACTCTCCTGCCCCCGGCGCCACCGTCAACGACCTCCTCACCATCTTCGCCAAGTTCAACTTCACCGCCAAGGATCTTGCCGTCCTCTCAG
GTGCGCACACGATCGGCAAG
GCCCACTGCTCCGCCTTCTCCACCCGCCTCTACAGCAACTCCTCCTCCAACGGCGGCCCCACGCTGGACGCCAACTACACGACGGCGCTCCGCGGGCAGTGCAAGGTCGGCGACGTGGAC
ACCCTCGTCGACCTCGACCCCCCAACCCCGACCACCTTCGACACCGACTACTACAAGCAGGTGGCCGCGCAGCGGGGCCTCCTCGCCACCGACGCCGCGCTTCTCCTCAACGCCGACACC
AAGGCCTACGTCCTCCGCCAGGCCAACGCCACCTCCGACGACGAGTTCTTCGCCGACTTCATCGTCTCCTTCGTCAACATGAGCAAGATCGGCGTGCTCACCCACTCCCACGGCGAGATC
AGGCACAAGTGCTCTGCTGTCAACCCGCCGTCGCCGCCGTCCTCCGCCGCCGCCTCCATGCTCGCCACCTCGCTCGCCGGCTCGCTTCTCTTCCTCCTCGCGGGGGTCCTCGTGCTGCTC
TTCTGA

Retrieve as FASTA