Entry information : OsPrx96
Entry ID 1106
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx96
Name OsPrx96
Class Class III peroxidase    [Orthogroup: Prx154]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx96
start..stop
S start..stop
SiPrx84 455 1e-162 12..328 16..332
BdiPrx36 442 1e-157 26..328 31..333
ZmPrx89 435 2e-154 25..328 30..337
SbPrx28 416 9e-147 23..328 32..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 263468..263875 408 N° 2 263990..264155 166 N° 3 264238..264650 413  
join(263468..263875,263990..264155,264238..264650)


exon

Literature and cross-references OsPrx96
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8L4E6
DNA ref. GenBank:   NC_008400.1 (263468..264647)
Protein sequence: OsPrx96
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   35008.17 (32191.7)  
PI (pH):   %s   4.87 (4.66) Peptide Signal:   %s   cut: 28 range:28-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMSRSLCRWTAVVVVVVAAMAAGEARAQLQYGFYNTSCPGVEEVVRSELKGIFSNDTTLRAGLLRLHFHDCFVRGCDASLMLNSHNATAEKDADPNLTVRGYEAIEAVKAKVEATCPLVVSCADIMAMAARDAVYFSDGPEYEVETGRRDGNVSNMAEALTNLPPSDGNVTVMTQYFAVKNLTMKDMVVLSAAHTIGVAHCTSFSKRLYNFTGAGDQDPSLDPAFAKQLAAVCKPGNVASVEPLDALTPVKFDNGYYKSLAAHQALLGSDAGLIDDSLTGAYVRLMTNDTNLDTFFADFAVSMINMGRVGVLTGTDGQIRPTCGIYVD

Retrieve as FASTA  
Remarks chromosome 7. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGTAGGAGTTTGTGCAGGTGGACGGCGGTGGTGGTGGTGGTGGTGGCGGCGATGGCGGCCGGAGAGGCGAGGGCGCAGCTGCAGTACGGGTTCTACAACACGTCGTGCCCTGGG
GTGGAGGAGGTGGTGCGGAGCGAGCTGAAGGGGATCTTCTCCAACGACACGACGCTCCGAGCCGGGCTCCTCCGGCTGCACTTCCACGACTGCTTCGTCCGCGGCTGCGACGCCTCCCTG
ATGCTCAACTCCCACAACGCCACCGCCGAGAAGGACGCCGACCCAAACCTCACCGTGCGTGGCTACGAGGCCATCGAGGCCGTCAAGGCCAAGGTCGAGGCCACCTGCCCGCTCGTCGTC
TCCTGCGCCGACATCATGGCCATGGCCGCGCGAGACGCCGTCTACTTC
GTACGCACGCACGCACGCCGGCCTCCTCTACATATCGTCAATGCATGCATAATGCGTATTAGCTAACCTACC
TTGCTGCATCGATATATATATATATATATATATATGATCCAGAGCGATGGCCCCGAGTACGAGGTGGAGACCGGACGGCGCGACGGCAACGTCTCCAACATGGCGGAGGCGCTCACCAAC
CTGCCGCCGTCCGACGGCAATGTCACCGTCATGACCCAATACTTCGCCGTCAAGAACCTCACCATGAAGGACATGGTCGTCCTCTCCG
GTAAGTACCTACGTGTAGTATTTGCCCAATCA
AACACTGATCGATCGATCGATCATTAAACTGAATATATATACGCATGCAGCCGCTCACACCATCGGCGTGGCGCACTGCACCTCCTTCTCCAAGCGGCTGTACAACTTCACCGGCGCCGG
CGACCAGGACCCGTCGCTGGACCCGGCGTTCGCCAAGCAGCTGGCGGCGGTGTGCAAGCCGGGGAACGTGGCCAGCGTGGAGCCCTTGGACGCTCTCACGCCGGTGAAGTTCGACAACGG
CTACTACAAGTCGTTGGCGGCGCACCAGGCGCTGCTCGGCTCCGACGCCGGCCTCATCGACGACAGCCTCACCGGCGCCTACGTCCGCCTCATGACCAACGACACCAACCTCGACACCTT
CTTCGCCGACTTCGCCGTCTCCATGATCAACATGGGCAGGGTCGGCGTCCTCACCGGCACCGACGGCCAAATCAGACCCACCTGCGGCATCTACGTCGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGTAGGAGTTTGTGCAGGTGGACGGCGGTGGTGGTGGTGGTGGTGGCGGCGATGGCGGCCGGAGAGGCGAGGGCGCAGCTGCAGTACGGGTTCTACAACACGTCGTGCCCTGGG
GTGGAGGAGGTGGTGCGGAGCGAGCTGAAGGGGATCTTCTCCAACGACACGACGCTCCGAGCCGGGCTCCTCCGGCTGCACTTCCACGACTGCTTCGTCCGCGGCTGCGACGCCTCCCTG
ATGCTCAACTCCCACAACGCCACCGCCGAGAAGGACGCCGACCCAAACCTCACCGTGCGTGGCTACGAGGCCATCGAGGCCGTCAAGGCCAAGGTCGAGGCCACCTGCCCGCTCGTCGTC
TCCTGCGCCGACATCATGGCCATGGCCGCGCGAGACGCCGTCTACTTC
AGCGATGGCCCCGAGTACGAGGTGGAGACCGGACGGCGCGACGGCAACGTCTCCAACATGGCGGAGGCGCTC
ACCAACCTGCCGCCGTCCGACGGCAATGTCACCGTCATGACCCAATACTTCGCCGTCAAGAACCTCACCATGAAGGACATGGTCGTCCTCTCCG
CCGCTCACACCATCGGCGTGGCGCAC
TGCACCTCCTTCTCCAAGCGGCTGTACAACTTCACCGGCGCCGGCGACCAGGACCCGTCGCTGGACCCGGCGTTCGCCAAGCAGCTGGCGGCGGTGTGCAAGCCGGGGAACGTGGCCAGC
GTGGAGCCCTTGGACGCTCTCACGCCGGTGAAGTTCGACAACGGCTACTACAAGTCGTTGGCGGCGCACCAGGCGCTGCTCGGCTCCGACGCCGGCCTCATCGACGACAGCCTCACCGGC
GCCTACGTCCGCCTCATGACCAACGACACCAACCTCGACACCTTCTTCGCCGACTTCGCCGTCTCCATGATCAACATGGGCAGGGTCGGCGTCCTCACCGGCACCGACGGCCAAATCAGA
CCCACCTGCGGCATCTACGTCGACTGA

Retrieve as FASTA