Entry information : CheCP10
Entry ID 11060
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2012-05-21 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Peroxidase information: CheCP10
Name CheCP10
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheCP10
start..stop
S start..stop
CheCP_C5 1565 0 1..761 1..761
CheCP_C4 1565 0 1..761 1..761
COsaCP 1549 0 1..761 1..761
SturCP 1448 0 1..761 1..759
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 358867..359129 263 N° 2 359186..359661 476 N° 3 359712..361258 1547  
join(358867..359129,359186..359661,359712..361258)


exon

Literature and cross-references CheCP10
DNA ref. JGI genome:   scaffold_19 (358867..361258)
Protein sequence: CheCP10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   761
PWM (Da):   %s   84313.19  
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKGECPVKKVPNVAGAGTRNADWWPNELRVNILRQHDPRQNPLGPDFNYAEEFKKLDYDALKKDLTALMTDSQDWWPADFGHYGGFFVRLAWHAAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLLLLVGNVAIESMGCPTFGFAGGRSDTFQSDESVYWGGETEWLGSDVRYADGAKGIKGEGIMDGDQHKNDAKSTHTSRNLEQPLAASHMGLIYVNPGPEGVPDPVAAGHDIRTTFGRMAMNDEETAALIVGGHTFGKTHGAAPSENTGPDPNSEDLATQGLGWVNKHGRGNGPDTITSGLEVTWTSTPVKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDEELIPDAFDPNKKHKPRMLTTDLSMRMDPAYEKITRRWLDHPEELHDAFTRAWFKLLHRDMGPRSRWIGPEIPKEILLWEDPVPEPEGEIIGESEIQTLKKQVLDAGIEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGIQSKFNSGSSKKVSLADLIVLAGTAAVEKAAGVPVPFAPGRTDASQEQTDVQSFEHLEPVTDGFRNYGKGTERVRTEQLDVDKAHLLRLTAPEMVVLTGGMRALNANWDGSSHGIFTQRPGQLTNDFFVNLLDNNLEWKATDASKELYEGFDRKTGQKKWTGTRHDLVFGHHPELRAIAETYASSDNANKFVKDFVAGWEKVMNNDRYDIKNKSVSTPLSGASRPRL

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCTGTCAAGAAGGTGCCCAACGTCGCCGGCGCCGGCACAAGAAACGCGGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAGCACGACCCCAGA
CAGAACCCTCTTGGCCCCGACTTCAACTACGCTGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCACGGCCTTGATGACCGACTCGCAGGACTGGTGGCCTGCCGAC
TTTGGCCACTATGGAGGCTTTTT
GTACGTTTAGCCCTTTGCCCTTGTCCCTCAGTCTCGTCTTCTAACCCTGCGAATAGCGTCCGTCTGGCATGGCACGCTGCTGGAACATACCGTGTCA
CTGACGGCCGTGGTGGCGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCCTGGCCCGACAACGTCTCCCTCGACAAGGCCCGCCGCCTGCTCTGGCCCATCAAGCAGAAGTACG
GAAACAAGATCTCATGGGCCGATCTTCTGCTTCTCGTCGGAAACGTTGCCATTGAGTCCATGGGATGCCCAACCTTTGGTTTCGCTGGTGGCCGCTCAGACACCTTCCAGTCGGACGAGT
CTGTCTACTGGGGCGGCGAGACCGAGTGGCTCGGCAGCGACGTCCGTTATGCCGACGGCGCAAAGGGTATCAAGGGCGAGGGTATCATGGATGGTGACCAGCACAAGAACGACGCCAAGA
GTACCCACACATCGAGAAATCTTGAGCAGCCACTGGCTGCCTCACACATGGGTCTCATCTATGTGAACCCAGAGG
GTAGGTTTCCTCTTAGAATACACATCTCTACTTGTTACTGACTCA
TCCAGGTCCCGAGGGTGTACCCGACCCCGTTGCCGCTGGCCACGACATCCGCACAACCTTTGGCCGTATGGCTATGAATGACGAGGAAACCGCTGCTCTCATTGTTGGTGGCCACACATT
CGGAAAGACACACGGTGCCGCCCCCAGCGAAAACACTGGCCCAGACCCCAACTCGGAAGACCTTGCAACCCAAGGTCTCGGTTGGGTGAACAAGCACGGCCGTGGCAACGGTCCAGATAC
CATCACCAGTGGTCTCGAGGTCACATGGACTAGCACACCCGTCAAGTGGAGTAACAAGTACCTGGAGTACCTCTACAAGTTTGAATGGGAGCTGGAGAAGAGCCCTGCTGGTGCCAACCA
ATGGGTTGCTAAGACAGATGAGGAGCTTATTCCAGACGCCTTCGACCCCAACAAGAAGCACAAGCCCAGGATGCTTACCACTGACTTGTCGATGCGCATGGACCCTGCCTACGAGAAGAT
CACCCGCCGCTGGCTAGACCACCCTGAGGAACTGCACGACGCTTTTACTCGTGCCTGGTTCAAGCTTCTTCACCGTGACATGGGTCCCCGCTCCAGATGGATCGGCCCAGAGATTCCCAA
GGAGATTCTCCTCTGGGAGGACCCTGTTCCTGAGCCAGAGGGTGAGATCATTGGCGAGTCTGAGATCCAGACTTTGAAGAAGCAGGTCCTCGACGCCGGCATTGAGCCTGCCAAGCTCAT
CCGCACTGCTTGGGCTTCTGCAGCTTCTTTCCGTGGTAGCGACAAGCGTGGTGGCGCCAATGGTGCTCGTATCCGCCTCGCTCCCCAGAAGGACTGGGAGGTAAACAACCCCAAGGAGTT
GGCTGAGGTTCTCAAGGCTCTTGAGGGTATTCAGTCCAAGTTCAACAGCGGCAGCAGCAAGAAGGTCTCTCTGGCCGACTTGATTGTCCTTGCTGGTACCGCCGCCGTTGAGAAGGCTGC
CGGTGTGCCTGTTCCCTTTGCGCCGGGCCGCACCGACGCTTCCCAGGAGCAGACTGACGTGCAGTCTTTCGAGCACCTTGAGCCCGTCACAGATGGTTTCCGCAACTACGGAAAGGGCAC
CGAGCGTGTCCGCACCGAGCAGCTCGATGTTGACAAGGCCCACCTTCTCCGGCTTACTGCCCCTGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAATGCCAACTGGGACGGCTC
CTCTCACGGCATCTTTACCCAGCGCCCGGGCCAGCTCACCAACGACTTCTTTGTCAACTTGCTCGATAACAACCTTGAATGGAAGGCAACCGACGCTAGCAAGGAGCTATACGAGGGTTT
CGACCGCAAGACTGGCCAGAAGAAGTGGACGGGCACACGTCACGACCTTGTCTTTGGTCACCACCCTGAACTCCGTGCCATTGCCGAGACGTACGCATCATCGGACAACGCGAACAAGTT
TGTCAAGGACTTTGTTGCTGGATGGGAGAAGGTTATGAACAACGACCGCTATGACATCAAGAACAAGTCGGTGAGTACACCATTGAGCGGGGCAAGCCGGCCTCGTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCTGTCAAGAAGGTGCCCAACGTCGCCGGCGCCGGCACAAGAAACGCGGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAGCACGACCCCAGA
CAGAACCCTCTTGGCCCCGACTTCAACTACGCTGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCACGGCCTTGATGACCGACTCGCAGGACTGGTGGCCTGCCGAC
TTTGGCCACTATGGAGGCTTTTT
CGTCCGTCTGGCATGGCACGCTGCTGGAACATACCGTGTCACTGACGGCCGTGGTGGCGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCC
TGGCCCGACAACGTCTCCCTCGACAAGGCCCGCCGCCTGCTCTGGCCCATCAAGCAGAAGTACGGAAACAAGATCTCATGGGCCGATCTTCTGCTTCTCGTCGGAAACGTTGCCATTGAG
TCCATGGGATGCCCAACCTTTGGTTTCGCTGGTGGCCGCTCAGACACCTTCCAGTCGGACGAGTCTGTCTACTGGGGCGGCGAGACCGAGTGGCTCGGCAGCGACGTCCGTTATGCCGAC
GGCGCAAAGGGTATCAAGGGCGAGGGTATCATGGATGGTGACCAGCACAAGAACGACGCCAAGAGTACCCACACATCGAGAAATCTTGAGCAGCCACTGGCTGCCTCACACATGGGTCTC
ATCTATGTGAACCCAGAGG
GTCCCGAGGGTGTACCCGACCCCGTTGCCGCTGGCCACGACATCCGCACAACCTTTGGCCGTATGGCTATGAATGACGAGGAAACCGCTGCTCTCATTGTT
GGTGGCCACACATTCGGAAAGACACACGGTGCCGCCCCCAGCGAAAACACTGGCCCAGACCCCAACTCGGAAGACCTTGCAACCCAAGGTCTCGGTTGGGTGAACAAGCACGGCCGTGGC
AACGGTCCAGATACCATCACCAGTGGTCTCGAGGTCACATGGACTAGCACACCCGTCAAGTGGAGTAACAAGTACCTGGAGTACCTCTACAAGTTTGAATGGGAGCTGGAGAAGAGCCCT
GCTGGTGCCAACCAATGGGTTGCTAAGACAGATGAGGAGCTTATTCCAGACGCCTTCGACCCCAACAAGAAGCACAAGCCCAGGATGCTTACCACTGACTTGTCGATGCGCATGGACCCT
GCCTACGAGAAGATCACCCGCCGCTGGCTAGACCACCCTGAGGAACTGCACGACGCTTTTACTCGTGCCTGGTTCAAGCTTCTTCACCGTGACATGGGTCCCCGCTCCAGATGGATCGGC
CCAGAGATTCCCAAGGAGATTCTCCTCTGGGAGGACCCTGTTCCTGAGCCAGAGGGTGAGATCATTGGCGAGTCTGAGATCCAGACTTTGAAGAAGCAGGTCCTCGACGCCGGCATTGAG
CCTGCCAAGCTCATCCGCACTGCTTGGGCTTCTGCAGCTTCTTTCCGTGGTAGCGACAAGCGTGGTGGCGCCAATGGTGCTCGTATCCGCCTCGCTCCCCAGAAGGACTGGGAGGTAAAC
AACCCCAAGGAGTTGGCTGAGGTTCTCAAGGCTCTTGAGGGTATTCAGTCCAAGTTCAACAGCGGCAGCAGCAAGAAGGTCTCTCTGGCCGACTTGATTGTCCTTGCTGGTACCGCCGCC
GTTGAGAAGGCTGCCGGTGTGCCTGTTCCCTTTGCGCCGGGCCGCACCGACGCTTCCCAGGAGCAGACTGACGTGCAGTCTTTCGAGCACCTTGAGCCCGTCACAGATGGTTTCCGCAAC
TACGGAAAGGGCACCGAGCGTGTCCGCACCGAGCAGCTCGATGTTGACAAGGCCCACCTTCTCCGGCTTACTGCCCCTGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAATGCC
AACTGGGACGGCTCCTCTCACGGCATCTTTACCCAGCGCCCGGGCCAGCTCACCAACGACTTCTTTGTCAACTTGCTCGATAACAACCTTGAATGGAAGGCAACCGACGCTAGCAAGGAG
CTATACGAGGGTTTCGACCGCAAGACTGGCCAGAAGAAGTGGACGGGCACACGTCACGACCTTGTCTTTGGTCACCACCCTGAACTCCGTGCCATTGCCGAGACGTACGCATCATCGGAC
AACGCGAACAAGTTTGTCAAGGACTTTGTTGCTGGATGGGAGAAGGTTATGAACAACGACCGCTATGACATCAAGAACAAGTCGGTGAGTACACCATTGAGCGGGGCAAGCCGGCCTCGT
TTGTAA

Retrieve as FASTA