Entry information : CheKat01_C5
Entry ID 11062
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2012-05-21 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-21 (Christophe Dunand)
Peroxidase information: CheKat01_C5
Name CheKat01_C5
Class Catalase    [Orthogroup: Kat002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheKat01_C5
start..stop
S start..stop
CheKat01_C4 1147 0 1..547 1..547
PnoKat01 967 0 1..546 1..546
CtheKat3 902 0 1..546 37..582
CcinKat03 801 0 3..546 26..576
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12152..13606 1455 N° 2 11891..12079 189  
complement(join(11891..12079,12152..13606))


exon

Literature and cross-references CheKat01_C5
DNA ref. JGI genome:   scaffold_30 (13606..11891)
Protein sequence: CheKat01_C5
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   547
PWM (Da):   %s   62748.55  
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQSSNEGPADIIAKVAGVTQGGKREDDGPYFTNNEGIPWPDAEHSKTIGGIPVASDVFLFQKQQTFNRSKNLERMVHPCGSGAFGYFETTKDVTHLTKADFLKTVGEKTPIFIRFSTVTPGREYPDEARNPRGFAIKFYTGEGNYDIVGLNFPVFFCRDPIQGPDVIRSQWRNPKNFLFDYDAIFDLLANTPEGNHAGLMFFSDHGTPQGWRFNHGYGCHTFKWVNKDGQFVYIKYHFVAEHGQKQFTQEQATQMCGEDPDYSKRDLYETIENGEEVVWKAHVQVMSPEEADPDKLGFDPFDVTKVWPRKQFPMQEFGRLVLNKNPENFHRDVEQAAFSPGSMVPGVEDSPDPLLQFRMFFYRDAQYHRIGVNLHQIPVNCPFMAKSFASLNFDGQMRVDANHAGNKPYAPNSFAHKFRPDVAEAPYQVNDNIMSRKSHYWHEGKKNEYDQAKELWSRVMSVQEKQNTIKNTANMLKFVRYPEIQQYNIGTDLSRGIYDLLPKPAFDFSEVEELSHTAHEWYKEKKFRSIDGERLTGFPPSMPVYNY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCTCAAATGAGGGCCCAGCAGACATCATCGCCAAGGTTGCTGGGGTTACTCAGGGTGGAAAGCGTGAAGATGACGGCCCATATTTCACCAACAATGAAGGCATTCCATGGCCC
GACGCAGAACATAGCAAGACCATCGGCGGAATCCCAGTCGCTAGCGATGTTTTCCTCTTCCAGAAGCAGCAGACATTTAACCGCTCAAAAAATCTCGAGCGCATGGTGCACCCCTGTGGT
TCAGGTGCTTTTGGTTATTTCGAGACCACCAAAGATGTCACCCACCTCACCAAGGCCGACTTTTTGAAGACTGTAGGTGAGAAGACGCCCATATTCATACGATTCAGTACCGTTACTCCT
GGACGCGAGTATCCCGACGAAGCTCGTAACCCTCGTGGATTTGCCATCAAGTTCTATACTGGAGAAGGCAACTACGACATCGTTGGGTTGAACTTCCCAGTTTTCTTCTGCCGTGATCCT
ATCCAGGGCCCAGATGTCATCCGATCGCAATGGCGTAACCCCAAGAACTTCCTTTTCGATTACGATGCTATTTTCGACTTGCTTGCCAACACCCCCGAGGGTAACCACGCTGGCCTAATG
TTCTTCAGTGACCATGGCACGCCCCAGGGTTGGCGTTTCAACCACGGGTATGGATGCCACACGTTCAAGTGGGTGAACAAGGACGGTCAATTCGTGTACATCAAGTACCACTTTGTTGCT
GAGCACGGTCAAAAGCAATTCACCCAGGAACAAGCGACACAAATGTGTGGCGAGGACCCTGACTATTCCAAGCGTGATCTATATGAGACTATTGAGAATGGCGAGGAGGTAGTCTGGAAA
GCACACGTACAGGTCATGAGCCCAGAGGAAGCCGATCCCGATAAGCTTGGCTTCGATCCTTTTGACGTCACCAAGGTCTGGCCGCGTAAGCAATTTCCTATGCAAGAGTTTGGACGCCTG
GTTTTGAACAAGAACCCTGAAAATTTCCATCGTGACGTCGAGCAGGCGGCCTTCTCCCCGGGTAGCATGGTGCCCGGTGTTGAAGACTCGCCTGATCCACTTCTTCAGTTCCGCATGTTC
TTCTACCGCGATGCGCAGTACCACCGTATTGGTGTGAACTTGCACCAGATTCCCGTCAACTGCCCATTCATGGCCAAGTCTTTCGCATCCCTCAATTTTGATGGCCAGATGCGTGTCGAT
GCCAATCATGCTGGGAACAAGCCGTATGCCCCAAACAGCTTCGCGCACAAGTTCCGGCCCGATGTCGCTGAAGCACCATACCAGGTCAATGACAACATCATGAGCCGAAAGAGTCATTAT
TGGCATGAGGGCAAGAAGAACGAGTACGACCAGGCTAAGGAGCTTTGGTCACGCGTAATGAGCGTACAGGAGAAGCAAAACACCATCAAGAACACCGCAAACATGCTTAAGTTTGTCCGA
TACCCCGAGATTCAG
GTAAATTCTCCCTGACAGATTCCGCACATCGCGTTTTCGCTAACAATCTTGAAGAAGAAGTACCTGGCGCAGCAATATAATATCGGTACCGACCTGTCGAGAGGC
ATTTACGACCTCCTCCCGAAGCCAGCGTTCGATTTCAGCGAAGTCGAGGAGCTTTCTCACACAGCCCATGAGTGGTATAAGGAGAAGAAGTTTAGGTCTATCGATGGCGAGAGGCTTACA
GGTTTCCCTCCATCGATGCCTGTTTATAATTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGCTCAAATGAGGGCCCAGCAGACATCATCGCCAAGGTTGCTGGGGTTACTCAGGGTGGAAAGCGTGAAGATGACGGCCCATATTTCACCAACAATGAAGGCATTCCATGGCCC
GACGCAGAACATAGCAAGACCATCGGCGGAATCCCAGTCGCTAGCGATGTTTTCCTCTTCCAGAAGCAGCAGACATTTAACCGCTCAAAAAATCTCGAGCGCATGGTGCACCCCTGTGGT
TCAGGTGCTTTTGGTTATTTCGAGACCACCAAAGATGTCACCCACCTCACCAAGGCCGACTTTTTGAAGACTGTAGGTGAGAAGACGCCCATATTCATACGATTCAGTACCGTTACTCCT
GGACGCGAGTATCCCGACGAAGCTCGTAACCCTCGTGGATTTGCCATCAAGTTCTATACTGGAGAAGGCAACTACGACATCGTTGGGTTGAACTTCCCAGTTTTCTTCTGCCGTGATCCT
ATCCAGGGCCCAGATGTCATCCGATCGCAATGGCGTAACCCCAAGAACTTCCTTTTCGATTACGATGCTATTTTCGACTTGCTTGCCAACACCCCCGAGGGTAACCACGCTGGCCTAATG
TTCTTCAGTGACCATGGCACGCCCCAGGGTTGGCGTTTCAACCACGGGTATGGATGCCACACGTTCAAGTGGGTGAACAAGGACGGTCAATTCGTGTACATCAAGTACCACTTTGTTGCT
GAGCACGGTCAAAAGCAATTCACCCAGGAACAAGCGACACAAATGTGTGGCGAGGACCCTGACTATTCCAAGCGTGATCTATATGAGACTATTGAGAATGGCGAGGAGGTAGTCTGGAAA
GCACACGTACAGGTCATGAGCCCAGAGGAAGCCGATCCCGATAAGCTTGGCTTCGATCCTTTTGACGTCACCAAGGTCTGGCCGCGTAAGCAATTTCCTATGCAAGAGTTTGGACGCCTG
GTTTTGAACAAGAACCCTGAAAATTTCCATCGTGACGTCGAGCAGGCGGCCTTCTCCCCGGGTAGCATGGTGCCCGGTGTTGAAGACTCGCCTGATCCACTTCTTCAGTTCCGCATGTTC
TTCTACCGCGATGCGCAGTACCACCGTATTGGTGTGAACTTGCACCAGATTCCCGTCAACTGCCCATTCATGGCCAAGTCTTTCGCATCCCTCAATTTTGATGGCCAGATGCGTGTCGAT
GCCAATCATGCTGGGAACAAGCCGTATGCCCCAAACAGCTTCGCGCACAAGTTCCGGCCCGATGTCGCTGAAGCACCATACCAGGTCAATGACAACATCATGAGCCGAAAGAGTCATTAT
TGGCATGAGGGCAAGAAGAACGAGTACGACCAGGCTAAGGAGCTTTGGTCACGCGTAATGAGCGTACAGGAGAAGCAAAACACCATCAAGAACACCGCAAACATGCTTAAGTTTGTCCGA
TACCCCGAGATTCAG
CAATATAATATCGGTACCGACCTGTCGAGAGGCATTTACGACCTCCTCCCGAAGCCAGCGTTCGATTTCAGCGAAGTCGAGGAGCTTTCTCACACAGCCCATGAG
TGGTATAAGGAGAAGAAGTTTAGGTCTATCGATGGCGAGAGGCTTACAGGTTTCCCTCCATCGATGCCTGTTTATAATTACTGA

Retrieve as FASTA