Entry information : OsPrx97
Entry ID 1107
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx97
Name OsPrx97
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx97
start..stop
S start..stop
SbPrx24 543 0 24..342 20..336
SiPrx85 533 0 41..342 30..331
TaPrx108 513 0 37..342 29..336
ZmPrx51 508 0 40..342 31..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 234998..235252 255 N° 2 235328..236104 777  
join(234998..235252,235328..236104)


exon

Literature and cross-references OsPrx97
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1J6
DNA ref. GenBank:   NC_008400.1 (234998..236101)
Protein sequence: OsPrx97
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343
PWM (Da):   %s   37181.66 Transmb domain:   %s   i21-40o
PI (pH):   %s   7.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWRNSGRVKVMNRRSSRMAVMAAAVLAVCSFAAVTMAQLEMDFYSKTCPNVEEIVRREMEEILRVAPTLAGPLLRLHFHDCFVRGCDASVLIDSTAGNVAEKDAKPNLTLRGFGAVQRVKDKLNAACPATVSCADVLALMARDAVVLANGPSWPVSLGRRDGRLSIANDTNQLPPPTANFTQLSQMFAAKGLDAKDLVVLSGGHTLGTAHCALFSDRLYNFTGLVNDGDVDPALDAAYMAKLKAKCRSLSDNTTLSEMDPGSFLTFDASYYRLVAKRRGIFHSDSALLTDPVTRAYVERQATGHFADDFFRDFADSMVKMSTIDVLTGAQGEIRNKCYAINI*

Retrieve as FASTA  
Remarks chromosome 7. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGGAACAGCGGGCGGGTGAAGGTGATGAACAGGAGGAGCAGCAGGATGGCAGTCATGGCAGCCGCCGTGCTGGCCGTGTGCAGCTTTGCGGCGGTGACCATGGCCCAGCTG
GAGATGGACTTCTACAGCAAGACGTGCCCGAACGTCGAGGAGATCGTCCGGCGGGAGATGGAGGAGATCCTCCGGGTGGCGCCGACGCTCGCCGGCCCGCTCCTCCGCCTCCATTTCCAC
GACTGCTTCGTCAGG
GTACTGTCTCATGCATCTCATCGATCGATCGATCATATCGCTAGCTAGCTTGCTTTAATTTAATTACTCCTGCAGGGGTGCGACGCGTCGGTGCTGATTGACTCG
ACGGCCGGCAACGTGGCGGAGAAGGACGCCAAGCCCAACCTCACTCTCCGCGGCTTCGGGGCGGTGCAGCGGGTCAAGGACAAGCTCAACGCCGCCTGCCCGGCCACCGTCTCCTGCGCC
GACGTCCTCGCCCTCATGGCCCGTGACGCCGTCGTCCTCGCCAACGGGCCCTCCTGGCCCGTCTCGCTCGGCCGCCGCGACGGCCGCCTCTCCATCGCCAACGACACCAACCAGCTGCCG
CCCCCCACCGCCAACTTCACCCAGCTCTCCCAGATGTTCGCCGCCAAAGGCCTCGACGCCAAGGACCTCGTCGTCCTCTCCGGCGGCCACACGCTCGGCACGGCGCACTGCGCGCTCTTC
TCCGACCGCCTCTACAACTTCACCGGCCTGGTGAACGACGGCGACGTGGACCCGGCGCTGGACGCGGCGTACATGGCGAAGCTCAAGGCCAAGTGCCGGAGCCTGAGCGACAACACCACC
CTGTCGGAGATGGACCCCGGCAGCTTCCTCACCTTCGACGCCAGCTACTACCGGCTGGTGGCCAAGCGCCGCGGCATCTTCCACTCCGACTCCGCGCTGCTCACCGATCCCGTCACCAGG
GCCTACGTCGAGCGCCAGGCCACCGGCCACTTCGCCGACGACTTCTTCCGCGACTTCGCCGACTCCATGGTGAAGATGAGCACCATTGACGTGCTCACCGGGGCGCAGGGCGAGATCAGG
AACAAGTGCTACGCCATCAACATATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGGAACAGCGGGCGGGTGAAGGTGATGAACAGGAGGAGCAGCAGGATGGCAGTCATGGCAGCCGCCGTGCTGGCCGTGTGCAGCTTTGCGGCGGTGACCATGGCCCAGCTG
GAGATGGACTTCTACAGCAAGACGTGCCCGAACGTCGAGGAGATCGTCCGGCGGGAGATGGAGGAGATCCTCCGGGTGGCGCCGACGCTCGCCGGCCCGCTCCTCCGCCTCCATTTCCAC
GACTGCTTCGTCAGG
GGGTGCGACGCGTCGGTGCTGATTGACTCGACGGCCGGCAACGTGGCGGAGAAGGACGCCAAGCCCAACCTCACTCTCCGCGGCTTCGGGGCGGTGCAGCGGGTC
AAGGACAAGCTCAACGCCGCCTGCCCGGCCACCGTCTCCTGCGCCGACGTCCTCGCCCTCATGGCCCGTGACGCCGTCGTCCTCGCCAACGGGCCCTCCTGGCCCGTCTCGCTCGGCCGC
CGCGACGGCCGCCTCTCCATCGCCAACGACACCAACCAGCTGCCGCCCCCCACCGCCAACTTCACCCAGCTCTCCCAGATGTTCGCCGCCAAAGGCCTCGACGCCAAGGACCTCGTCGTC
CTCTCCGGCGGCCACACGCTCGGCACGGCGCACTGCGCGCTCTTCTCCGACCGCCTCTACAACTTCACCGGCCTGGTGAACGACGGCGACGTGGACCCGGCGCTGGACGCGGCGTACATG
GCGAAGCTCAAGGCCAAGTGCCGGAGCCTGAGCGACAACACCACCCTGTCGGAGATGGACCCCGGCAGCTTCCTCACCTTCGACGCCAGCTACTACCGGCTGGTGGCCAAGCGCCGCGGC
ATCTTCCACTCCGACTCCGCGCTGCTCACCGATCCCGTCACCAGGGCCTACGTCGAGCGCCAGGCCACCGGCCACTTCGCCGACGACTTCTTCCGCGACTTCGCCGACTCCATGGTGAAG
ATGAGCACCATTGACGTGCTCACCGGGGCGCAGGGCGAGATCAGGAACAAGTGCTACGCCATCAACATATAA

Retrieve as FASTA