Entry information : FoCP03
Entry ID 11072
Creation 2012-04-23 (Catherine Mathe (Scipio))
Last sequence changes 2012-05-22 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoCP03
Name FoCP03
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoCP03
start..stop
S start..stop
FoCP02-1 1555 0 1..781 1..781
FoCP04 1510 0 1..777 1..777
GmoCP02 1506 0 1..777 1..777
GzCP02 1322 0 21..777 20..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 666276..666561 286 N° 2 666613..666767 155 N° 3 666821..666893 73 N° 4 666942..667373 432
N° 5 667427..667562 136 N° 6 667612..668875 1264  
join(666276..666561,666613..666767,666821..666893,666942..667373,667427..667562, 667612..668875)


exon

Literature and cross-references FoCP03
DNA ref. JGI genome:   Supercontig_2.22 (666276..668875)
Protein sequence: FoCP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   781 (763)
PWM (Da):   %s   85500.38 (83712.4)  
PI (pH):   %s   7.47 (7.45) Peptide Signal:   %s   cut: 19 range:19-781
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVQSLLLASGLVPLAASQGCPFAKRATDNNLVPPREIPEDFGICRVASNQAGGGTRSKDFWPCALRLDVLRQFSPQYSPLGADFDYTEAFKSLDYESLKKDLKALLTDSQDWWPADHGSYGGLFIRMSWHSAGTYRAMDGRGGAGGQQRFAPLDSWPDNQNLDKARRLLWPIKQKYGSKISWADLVVLAGNVALEHSGFETLGFAGGRADTWEADESIYWGAESTFVPKGNDVRYNGSTDIYERADKLEKPLGATHFGLIYVNPEGPDGSSDPKASALDIRTAFGRMGMDDEETAALIIGGHTLGKTHGAVSSKNIGPEPMAADLGGMGLGWHNSVNEGNGPDQMTSGLEVIWSTTPTKWSNHFLKSLLGNNWTLVESPAGHKQWEALDGKLEYPDPFVKGKFRRPTMLTSDLALINDPAYLKICKRWHDHPKEMNQAFARAWYKLLHRDLGPVSRYLGPEVAKEKFIWQDPLPERKGDIISEGDISSLKSAILSTDGLTVSKLVSTAWNSASTFRGTDKRGGANGARIALEPQVNWASNNPKQLKQVLSALKKVQKNFNSKSSSKQVSLADLIVLGGVAAVEKAAQDAGFKDVKVPFTPGRVAATQNQTDLVQFGYLEPLADGFRNYGHGTARARTEEILVDRAALLTLTPPEMTVLVGGLRALNANYDGSSNGILTEKKGQLTNDFFVNLLSPAFVWTKKDDRGELWTGTDRATKSAKWTATRADLVFGSHAELRAISEVYGSADAKEKFVKDFISAWTKVMNLDRFDVKTEKETKY

Retrieve as FASTA  
Remarks Incomplte: mismatches,
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTTCAATCACTTCTGCTTGCTTCTGGCCTCGTGCCTCTCGCCGCTAGTCAGGGCTGCCCTTTCGCCAAGCGAGCCACAGACAATAACCTTGTCCCCCCGCGAGAAATCCCCGAG
GATTTTGGTATCTGCCGCGTCGCTAGCAACCAGGCTGGTGGAGGTACCCGAAGCAAAGACTTTTGGCCTTGCGCTTTGAGGTTAGATGTTCTTCGACAATTTTCGCCTCAGTATAGCCCA
TTGGGTGCGGATTTTGACTACACTGAGGCCTTCAAGTCTCTGGACT
GTGAGTTTCATTATTTTGGGATCGAAACAGCTTGTCTGATTGATTGTGTAGATGAGAGCTTGAAGAAGGATCTC
AAGGCGCTTCTCACCGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAGCTATGGTGGTCTTTTCATCCGTATGTCATGGCACAGCGCTGGTACTTACCGTGCCATGGATGGCCGAGGT
GGCGCTGGAATG
GTGGGTGCAGAATCTGACTGAGATTTTATTGAGTTTTTCGCTGACATTTGCAGGGCCAACAACGATTTGCTCCTCTCGACAGCTGGCCCGACAACCAGAACCTTGACA
AGGCTCGCCGTCTGCTTT
GTACGTTTCACAATACCTATGCAAACAACCAATTCTAACAAATCACAGGGCCCATCAAGCAAAAGTATGGCAGCAAGATTTCATGGGCTGACCTGGTCGTTC
TCGCCGGCAACGTCGCCCTCGAACATAGTGGTTTCGAGACACTCGGTTTCGCCGGTGGCCGAGCCGACACCTGGGAGGCTGATGAGTCTATCTACTGGGGTGCCGAGTCTACCTTTGTTC
CCAAGGGTAACGATGTTCGCTACAACGGTAGCACTGACATTTATGAGCGAGCTGATAAGCTTGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTCATTTATGTTAACCCTGAGGGGCCTG
ATGGAAGCTCTGATCCTAAGGCTTCTGCTCTTGATATTCGTACTGCTTTTGGTCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACTCTGGGCAAGACTC
ACGGTGCTGTTTCTTCTA
GTAAGTGTCTCATCAGTCGAACAGTTTTGAGACCATGCTGACTGTGGTTTCAGAGAACATCGGCCCTGAGCCTATGGCTGCTGACCTTGGGGGGATGGGTCT
CGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACCAGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACCAA
GTGCGTCCTCTCCCTCTCATTAACCCTCACTCC
AATTAATAGTTCTCAGGTGGAGCAACCACTTCCTCAAGAGTCTTCTCGGCAATAACTGGACCCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTTGAAT
ACCCCGACCCCTTCGTCAAGGGCAAGTTCCGTAGGCCCACTATGCTCACCAGCGATCTCGCCCTCATTAATGACCCCGCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAGG
AGATGAACCAGGCTTTCGCTCGTGCTTGGTACAAGCTTCTCCACCGTGATCTCGGCCCTGTTTCTCGTTACCTCGGACCTGAGGTTGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCC
CTGAGCGAAAGGGAGACATCATCAGCGAGGGTGACATCTCTAGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCTAAGCTCGTTTCTACTGCTTGGAACTCTGCCTCTA
CTTTCCGTGGAACCGACAAGCGTGGTGGTGCCAACGGTGCTCGTATTGCTCTTGAGCCTCAGGTCAACTGGGCCAGCAACAACCCCAAGCAGCTCAAGCAGGTTCTCTCTGCTCTGAAGA
AGGTGCAGAAGAACTTCAACTCTAAGTCCAGTTCAAAGCAGGTCTCTCTCGCTGATCTGATTGTTCTCGGTGGTGTTGCTGCTGTTGAGAAGGCTGCTCAGGATGCTGGCTTCAAGGACG
TCAAGGTCCCTTTCACTCCTGGTCGTGTCGCTGCTACCCAGAACCAGACTGATCTTGTTCAGTTTGGTTACCTTGAGCCTCTTGCCGATGGTTTCCGCAACTACGGACATGGCACTGCCC
GTGCTCGCACCGAGGAGATCCTCGTTGACCGTGCCGCTCTTCTTACCCTTACTCCCCCCGAGATGACCGTCCTTGTCGGTGGTCTTCGTGCCCTCAACGCCAACTACGACGGCTCCTCCA
ACGGTATCCTCACTGAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCAACCTCCTTTCTCCCGCTTTCGTTTGGACCAAGAAGGACGACCGCGGCGAGCTCTGGACTGGTACTGACC
GTGCCACCAAGTCTGCCAAGTGGACTGCCACTCGTGCCGATCTTGTCTTCGGATCTCATGCTGAGCTACGTGCTATTTCCGAGGTTTATGGCAGCGCTGATGCAAAGGAGAAATTTGTGA
AGGATTTCATTTCTGCGTGGACCAAGGTTATGAACCTGGACCGCTTTGATGTCAAGACCGAGAAGGAGACCAAGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACGTTCAATCACTTCTGCTTGCTTCTGGCCTCGTGCCTCTCGCCGCTAGTCAGGGCTGCCCTTTCGCCAAGCGAGCCACAGACAATAACCTTGTCCCCCCGCGAGAAATCCCCGAG
GATTTTGGTATCTGCCGCGTCGCTAGCAACCAGGCTGGTGGAGGTACCCGAAGCAAAGACTTTTGGCCTTGCGCTTTGAGGTTAGATGTTCTTCGACAATTTTCGCCTCAGTATAGCCCA
TTGGGTGCGGATTTTGACTACACTGAGGCCTTCAAGTCTCTGGACT
ATGAGAGCTTGAAGAAGGATCTCAAGGCGCTTCTCACCGATTCTCAGGATTGGTGGCCTGCTGACCATGGTAGC
TATGGTGGTCTTTTCATCCGTATGTCATGGCACAGCGCTGGTACTTACCGTGCCATGGATGGCCGAGGTGGCGCTGGAATG
GGCCAACAACGATTTGCTCCTCTCGACAGCTGGCCCGAC
AACCAGAACCTTGACAAGGCTCGCCGTCTGCTTT
GGCCCATCAAGCAAAAGTATGGCAGCAAGATTTCATGGGCTGACCTGGTCGTTCTCGCCGGCAACGTCGCCCTCGAACATAGTGGT
TTCGAGACACTCGGTTTCGCCGGTGGCCGAGCCGACACCTGGGAGGCTGATGAGTCTATCTACTGGGGTGCCGAGTCTACCTTTGTTCCCAAGGGTAACGATGTTCGCTACAACGGTAGC
ACTGACATTTATGAGCGAGCTGATAAGCTTGAGAAGCCTCTTGGTGCTACTCACTTCGGTCTCATTTATGTTAACCCTGAGGGGCCTGATGGAAGCTCTGATCCTAAGGCTTCTGCTCTT
GATATTCGTACTGCTTTTGGTCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGTCACACTCTGGGCAAGACTCACGGTGCTGTTTCTTCTA
AGAACATCGGCCCT
GAGCCTATGGCTGCTGACCTTGGGGGGATGGGTCTCGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACCAGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACC
AA
GTGGAGCAACCACTTCCTCAAGAGTCTTCTCGGCAATAACTGGACCCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTTGAATACCCCGACCCCTTC
GTCAAGGGCAAGTTCCGTAGGCCCACTATGCTCACCAGCGATCTCGCCCTCATTAATGACCCCGCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAGGAGATGAACCAGGCT
TTCGCTCGTGCTTGGTACAAGCTTCTCCACCGTGATCTCGGCCCTGTTTCTCGTTACCTCGGACCTGAGGTTGCTAAGGAGAAGTTCATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGA
GACATCATCAGCGAGGGTGACATCTCTAGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCTAAGCTCGTTTCTACTGCTTGGAACTCTGCCTCTACTTTCCGTGGAACC
GACAAGCGTGGTGGTGCCAACGGTGCTCGTATTGCTCTTGAGCCTCAGGTCAACTGGGCCAGCAACAACCCCAAGCAGCTCAAGCAGGTTCTCTCTGCTCTGAAGAAGGTGCAGAAGAAC
TTCAACTCTAAGTCCAGTTCAAAGCAGGTCTCTCTCGCTGATCTGATTGTTCTCGGTGGTGTTGCTGCTGTTGAGAAGGCTGCTCAGGATGCTGGCTTCAAGGACGTCAAGGTCCCTTTC
ACTCCTGGTCGTGTCGCTGCTACCCAGAACCAGACTGATCTTGTTCAGTTTGGTTACCTTGAGCCTCTTGCCGATGGTTTCCGCAACTACGGACATGGCACTGCCCGTGCTCGCACCGAG
GAGATCCTCGTTGACCGTGCCGCTCTTCTTACCCTTACTCCCCCCGAGATGACCGTCCTTGTCGGTGGTCTTCGTGCCCTCAACGCCAACTACGACGGCTCCTCCAACGGTATCCTCACT
GAGAAGAAGGGCCAACTCACCAACGACTTCTTCGTCAACCTCCTTTCTCCCGCTTTCGTTTGGACCAAGAAGGACGACCGCGGCGAGCTCTGGACTGGTACTGACCGTGCCACCAAGTCT
GCCAAGTGGACTGCCACTCGTGCCGATCTTGTCTTCGGATCTCATGCTGAGCTACGTGCTATTTCCGAGGTTTATGGCAGCGCTGATGCAAAGGAGAAATTTGTGAAGGATTTCATTTCT
GCGTGGACCAAGGTTATGAACCTGGACCGCTTTGATGTCAAGACCGAGAAGGAGACCAAGTACTAG

Retrieve as FASTA