Entry information : FoCP02-2
Entry ID 11080
Creation 2012-04-23 (Catherine Mathe (Scipio))
Last sequence changes 2012-05-22 (Catherine Mathe (Scipio))
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: FoCP02-2
Name FoCP02-2
Class Catalase peroxidase     [Orthogroup: CP001]*
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Fusarium
Organism Fusarium oxysporum    [TaxId: 5507 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FoCP02-2
start..stop
S start..stop
FoCP02-1 1017 0 1..498 284..781
FoCP02-1 47 0.000009 223..323 125..212
FoCP03 981 0 1..498 284..781
FoCP03 47 0.000009 223..323 125..212
GmoCP02 941 0 1..494 284..777
GmoCP02 48 0.000005 223..323 125..212
FoCP04 940 0 1..494 284..777
FoCP04 45 0.00003 223..323 125..212
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96971..97067 97 N° 2 97121..97256 136 N° 3 97306..98569 1264  
join(96971..97067,97121..97256,97306..98569)


exon

Literature and cross-references FoCP02-2
DNA ref. JGI genome:   Supercontig_2.42 (96971..98569)
Protein sequence: FoCP02-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498
PWM (Da):   %s   54468.87  
PI (pH):   %s   7.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAFGRMGMDDEETAALIIGGHTLGKTHGAVSSKNIGPEPMAADLGEMGLGWHNSVNEGNGPDQMTSGLEVIWSTTPTKWSNHFLKSLLGNNWTLVESPAGHKQWEALDGKLEYPDPFVKGKFRRPTMLTSDLALINDPSYLKICKRWHDHPKEMNQAFARAWYKLLHRDLGPVSRYLGPEVPKEKFIWQDPLPERKGDIISEGDISSLKSAILSTDGLTVSKLVSTAWNSASTFRGTDKRGGANGARIALEPQVSWASNNPKQLKQVLSALKKIQKDFNSKSGPNQVSLADLIVLGGVAAVEKAAQDAGFKGVEVPFTPGRVDATQNQTDLVQFGYLEPLADGFRNYGHGTARARTEEILVDRAALLTLTPPEMTVLVGGLRALNANFDGSSNGILTEKKGQLTNDFFVNLLSPAYSWSKKDDRGELWTGTDRATKSAKWTATRADLVFGSHAELRAISEVYGSTDAKEKFVRDFISAWTKVMNLDRFDVKSEKEAKY

Retrieve as FASTA  
Remarks Partial sequence from genomic. 5'end is missing due to nnn in the sequence.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACTGCTTTTGGCCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGCCACACCCTGGGCAAGACTCACGGTGCTGTTTCTTCTAGTAAGTGTCTCATCTGTCGAACA
GGTTTGAGGCAATACTGATTGTGGTTTCAGAGAACATTGGCCCTGAGCCTATGGCTGCTGACCTTGGAGAGATGGGTCTCGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACC
AGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACCAA
GTACGTCCTCTCCCTCTCATTGACCCTCCCTCCAACTAATAGTTCTCAGGTGGAGCAACCACTTCCTCAAGAGT
CTTCTCGGCAACAACTGGACTCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTCGAATACCCAGACCCCTTCGTCAAGGGCAAGTTCCGCAGACCCACT
ATGCTCACCAGCGATCTCGCCCTCATTAATGACCCTTCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAGGAGATGAACCAGGCTTTCGCTCGTGCTTGGTACAAGCTTCTC
CACCGTGATCTCGGCCCTGTTTCTCGTTACCTTGGACCTGAGGTTCCTAAGGAGAAATTTATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGAGACATCATCAGCGAGGGTGACATCTCT
AGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCCAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGGACTGACAAGCGTGGTGGTGCCAACGGTGCT
CGCATTGCTCTTGAGCCTCAGGTCAGCTGGGCCAGCAACAACCCCAAGCAGCTGAAGCAGGTCCTCTCCGCCCTGAAGAAGATCCAGAAGGATTTCAACTCCAAGTCCGGCCCTAATCAG
GTCTCTCTCGCTGACCTGATCGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCCAGGATGCTGGCTTCAAGGGCGTTGAGGTTCCCTTCACTCCTGGTCGTGTTGATGCTACCCAG
AACCAGACCGATCTTGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGACGGGTTCCGTAACTACGGTCATGGCACTGCTCGTGCTCGCACCGAGGAGATTCTCGTTGACCGCGCTGCTCTT
CTTACCCTTACTCCTCCCGAGATGACCGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTTCGACGGCTCATCCAACGGTATCCTCACCGAGAAGAAGGGCCAACTCACCAACGAC
TTCTTCGTCAACCTTCTCTCTCCCGCCTACTCATGGAGCAAGAAGGACGACCGTGGTGAGCTCTGGACTGGTACTGACCGTGCCACCAAGTCCGCCAAGTGGACTGCTACCCGCGCTGAT
CTTGTCTTCGGATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTTTATGGTAGCACTGATGCGAAGGAGAAGTTTGTGAGGGATTTCATTTCAGCGTGGACCAAGGTTATGAACCTGGAC
CGCTTTGATGTCAAGTCTGAGAAGGAGGCCAAGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACTGCTTTTGGCCGTATGGGTATGGATGATGAGGAGACTGCTGCTCTCATCATTGGTGGCCACACCCTGGGCAAGACTCACGGTGCTGTTTCTTCTAAGAACATTGGCCCTGAGCCTATG
GCTGCTGACCTTGGAGAGATGGGTCTCGGCTGGCACAACAGCGTCAACGAGGGTAATGGCCCTGACCAGATGACCAGTGGCCTTGAGGTTATCTGGTCTACGACTCCCACCAA
GTGGAGC
AACCACTTCCTCAAGAGTCTTCTCGGCAACAACTGGACTCTGGTCGAGAGTCCCGCAGGCCACAAGCAATGGGAAGCCCTCGACGGCAAACTCGAATACCCAGACCCCTTCGTCAAGGGC
AAGTTCCGCAGACCCACTATGCTCACCAGCGATCTCGCCCTCATTAATGACCCTTCCTACCTCAAGATCTGCAAGCGCTGGCACGACCACCCCAAGGAGATGAACCAGGCTTTCGCTCGT
GCTTGGTACAAGCTTCTCCACCGTGATCTCGGCCCTGTTTCTCGTTACCTTGGACCTGAGGTTCCTAAGGAGAAATTTATCTGGCAGGATCCTCTCCCTGAGCGAAAGGGAGACATCATC
AGCGAGGGTGACATCTCTAGCCTCAAGTCTGCTATTCTTTCTACTGATGGTCTTACTGTTTCCAAGCTTGTTTCTACTGCTTGGAACTCTGCTTCTACTTTCCGTGGGACTGACAAGCGT
GGTGGTGCCAACGGTGCTCGCATTGCTCTTGAGCCTCAGGTCAGCTGGGCCAGCAACAACCCCAAGCAGCTGAAGCAGGTCCTCTCCGCCCTGAAGAAGATCCAGAAGGATTTCAACTCC
AAGTCCGGCCCTAATCAGGTCTCTCTCGCTGACCTGATCGTTCTCGGCGGTGTTGCCGCTGTTGAGAAGGCTGCCCAGGATGCTGGCTTCAAGGGCGTTGAGGTTCCCTTCACTCCTGGT
CGTGTTGATGCTACCCAGAACCAGACCGATCTTGTTCAGTTCGGTTACCTTGAGCCTCTTGCTGACGGGTTCCGTAACTACGGTCATGGCACTGCTCGTGCTCGCACCGAGGAGATTCTC
GTTGACCGCGCTGCTCTTCTTACCCTTACTCCTCCCGAGATGACCGTCCTTGTCGGTGGTCTCCGTGCCTTGAACGCCAACTTCGACGGCTCATCCAACGGTATCCTCACCGAGAAGAAG
GGCCAACTCACCAACGACTTCTTCGTCAACCTTCTCTCTCCCGCCTACTCATGGAGCAAGAAGGACGACCGTGGTGAGCTCTGGACTGGTACTGACCGTGCCACCAAGTCCGCCAAGTGG
ACTGCTACCCGCGCTGATCTTGTCTTCGGATCTCACGCTGAGCTGCGTGCTATTTCTGAGGTTTATGGTAGCACTGATGCGAAGGAGAAGTTTGTGAGGGATTTCATTTCAGCGTGGACC
AAGGTTATGAACCTGGACCGCTTTGATGTCAAGTCTGAGAAGGAGGCCAAGTACTAG

Retrieve as FASTA