Entry information : NgrKat02 (KatE)
Entry ID 11087
Creation 2012-05-29 (Christophe Dunand)
Last sequence changes 2012-05-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-29 (Christophe Dunand)
Peroxidase information: NgrKat02 (KatE)
Name (synonym) NgrKat02 (KatE)
Class Catalase     [Orthogroup: Kat001]*
Taxonomy Eukaryota Heterolobosea Vahlkampfiidae Naegleria
Organism Naegleria gruberi    [TaxId: 5762 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NgrKat02
start..stop
S start..stop
VpKat01 416 3e-140 113..586 6..475
PpuKat01 414 9e-140 112..586 4..474
PpuKat02 412 4e-139 112..586 4..474
NOpuKat01 409 1e-137 113..586 7..478
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 466473..467114 642 N° 2 466316..466418 103 N° 3 465668..466227 560 N° 4 465062..465613 552
complement(join(465062..465613,465668..466227,466316..466418,466473..467114))


exon

Literature and cross-references NgrKat02 (KatE)
Protein ref. UniProtKB:   D2VAE1
DNA ref. GenBank:   GG738859.1 (467114..465062)
Protein sequence: NgrKat02 (KatE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   618
PWM (Da):   %s   70132.88  
PI (pH):   %s   7.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQSPTGVQQQQVGLQQPNQPQLQQQPQQLQQQPQLQQQQYGKQTSGLQPSGIQSTQPKLQQEQGLESSQLSQQLKCPLGYGSDSFTSKEVSKQFGKIPGVIEQNEINRQNIITRQTGCPIGHVKDSLTSGSQGPLCVQDLDLLEKLQHFNTEKIPPRNVHALGTGAYGTFTVTNDISKYTCADLFNQVGKSTQFITRFSGIFTEVGDPETTRDPRGFAIKFYTKEGNWDLLGINTPVFAVRDAKAGPDQVHAFKRDPRTGCWNITQTWDYVANHPEGLHQMAMLFTDRTGTPLSYRTMNAYGCHTFSLVNSAKERFWVKFHLVSQQGAFGFNQHEAKLVAGEDPNFLSRDLYQSIEKQNFPRWKMMIQVMPEEEGYKHPWTFDATKVWKHADYPLIEVGTLEVNRNVVDYFTEVEQVAFSPATVVPGIGLSPDLLQGRLLIYDYTQIHRIGPNFKQLYVNRPHGIEPMNNYLGGNMYIPINDSFPHYTGSAFGGLKPNAKYIDPPFKVTGNCGLYEVPNEGSFEDLYSQVADFWKILPEKDKNNLCDNIAASFFRVTEQRVIDKMLQHFAQCDQQWAQIIQTKLKERREGKWMSESEKVCMNYAQQLLTMTRREAL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACAATCACCAACTGGAGTACAACAACAACAGGTTGGCTTACAACAACCCAATCAACCACAACTTCAACAGCAACCACAACAACTGCAACAACAACCACAACTTCAACAACAACAA
TATGGAAAGCAAACTTCTGGATTACAACCATCTGGAATTCAATCCACTCAACCAAAGCTTCAACAAGAACAAGGACTTGAAAGTAGTCAATTATCACAACAATTAAAATGTCCGCTTGGA
TATGGTTCAGACTCATTCACTTCCAAGGAAGTCAGTAAGCAATTTGGTAAAATTCCAGGTGTGATTGAACAAAATGAAATTAACAGACAAAATATCATTACAAGACAAACAGGTTGTCCA
ATTGGTCATGTCAAGGATTCTTTAACATCTGGCAGTCAAGGTCCACTTTGTGTTCAAGATTTGGATTTGTTAGAAAAGCTTCAACATTTCAATACTGAAAAGATTCCTCCAAGAAATGTA
CATGCTTTGGGAACTGGTGCTTATGGTACATTTACTGTGACAAATGACATTTCCAAGTATACTTGTGCTGATTTGTTTAATCAAGTTGGAAAGTCAACTCAATTTATTACTAGATTTTCT
GGTATCTTTACTGAAGTTGGAGATCCAGAAACTACAAGAGAT
GTAAGTTTTTAAGTTTAATATTGACTTTCGAATATCATTTTTTCAATTTCCAAGCCAAGAGGATTCGCTATCAAATTC
TATACTAAGGAAGGTAACTGGGATTTATTGGGCATCAACACTCCTGTCTTTGCTGTCAGAGATGCCAAAGCAGGTCCAG
GTAAGTTGTTTATTTCACTTTCCACTAACAATTTTTCAAAC
TAAACCTTTCCAACAACTAAACTCTACATTCTTCCTCAACCACACAGACCAAGTCCATGCTTTCAAACGTGATCCAAGAACTGGTTGCTGGAACATTACCCAAACCTGGGACTATGTTGC
CAACCACCCAGAAGGACTCCATCAAATGGCCATGCTCTTCACAGATCGAACTGGAACTCCTCTTTCCTACAGAACCATGAATGCTTATGGTTGCCACACTTTCTCATTGGTCAACTCTGC
CAAAGAACGTTTCTGGGTCAAATTCCATTTAGTTTCTCAACAAGGAGCTTTCGGTTTCAATCAACATGAAGCAAAATTAGTAGCAGGTGAGGATCCAAATTTCCTTTCTCGTGATTTGTA
TCAGTCAATTGAGAAACAGAATTTCCCTCGTTGGAAGATGATGATTCAGGTCATGCCAGAGGAGGAAGGTTACAAACATCCATGGACATTTGATGCTACAAAGGTTTGGAAACATGCAGA
TTATCCATTGATTGAGGTTGGTACGTTGGAGGTGAATAGAAATGTTGTGGATTATTTCACAGAGGTTGAACAAGTGGCCTTCTCTCCTGCTACTGTTGTTCCTGGAATTGGATTGAGTCC
TGATAAG
GTAAGTTTACTTGTTCATGAGTTTGAAATATTTATACATGTTTTTCGTTAATAGCTATTGCAAGGAAGATTATTAATTTATGATTATACTCAAATTCATCGTATTGGTCCAAA
CTTTAAGCAACTCTATGTCAATCGTCCACATGGCATTGAACCAATGAATAATTACCTGGGTGGTAACATGTACATTCCAATCAATGATTCCTTCCCTCACTATACTGGAAGTGCCTTTGG
AGGTTTGAAACCAAATGCCAAATACATTGATCCACCATTTAAGGTTACTGGAAATTGTGGTCTGTATGAAGTTCCAAATGAAGGTTCTTTCGAGGATTTGTATTCTCAAGTTGCTGATTT
CTGGAAGATTCTCCCAGAGAAGGATAAGAATAATTTGTGTGATAATATTGCTGCCAGCTTCTTTAGAGTGACTGAACAAAGAGTGATTGATAAAATGTTGCAACACTTTGCTCAATGTGA
TCAACAATGGGCTCAAATTATTCAGACCAAATTGAAGGAGAGAAGAGAAGGCAAATGGATGAGTGAGAGTGAAAAGGTCTGTATGAATTATGCTCAACAATTATTGACCATGACTCGTCG
AGAAGCTCTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACAATCACCAACTGGAGTACAACAACAACAGGTTGGCTTACAACAACCCAATCAACCACAACTTCAACAGCAACCACAACAACTGCAACAACAACCACAACTTCAACAACAACAA
TATGGAAAGCAAACTTCTGGATTACAACCATCTGGAATTCAATCCACTCAACCAAAGCTTCAACAAGAACAAGGACTTGAAAGTAGTCAATTATCACAACAATTAAAATGTCCGCTTGGA
TATGGTTCAGACTCATTCACTTCCAAGGAAGTCAGTAAGCAATTTGGTAAAATTCCAGGTGTGATTGAACAAAATGAAATTAACAGACAAAATATCATTACAAGACAAACAGGTTGTCCA
ATTGGTCATGTCAAGGATTCTTTAACATCTGGCAGTCAAGGTCCACTTTGTGTTCAAGATTTGGATTTGTTAGAAAAGCTTCAACATTTCAATACTGAAAAGATTCCTCCAAGAAATGTA
CATGCTTTGGGAACTGGTGCTTATGGTACATTTACTGTGACAAATGACATTTCCAAGTATACTTGTGCTGATTTGTTTAATCAAGTTGGAAAGTCAACTCAATTTATTACTAGATTTTCT
GGTATCTTTACTGAAGTTGGAGATCCAGAAACTACAAGAGAT
CCAAGAGGATTCGCTATCAAATTCTATACTAAGGAAGGTAACTGGGATTTATTGGGCATCAACACTCCTGTCTTTGCT
GTCAGAGATGCCAAAGCAGGTCCAG
ACCAAGTCCATGCTTTCAAACGTGATCCAAGAACTGGTTGCTGGAACATTACCCAAACCTGGGACTATGTTGCCAACCACCCAGAAGGACTCCAT
CAAATGGCCATGCTCTTCACAGATCGAACTGGAACTCCTCTTTCCTACAGAACCATGAATGCTTATGGTTGCCACACTTTCTCATTGGTCAACTCTGCCAAAGAACGTTTCTGGGTCAAA
TTCCATTTAGTTTCTCAACAAGGAGCTTTCGGTTTCAATCAACATGAAGCAAAATTAGTAGCAGGTGAGGATCCAAATTTCCTTTCTCGTGATTTGTATCAGTCAATTGAGAAACAGAAT
TTCCCTCGTTGGAAGATGATGATTCAGGTCATGCCAGAGGAGGAAGGTTACAAACATCCATGGACATTTGATGCTACAAAGGTTTGGAAACATGCAGATTATCCATTGATTGAGGTTGGT
ACGTTGGAGGTGAATAGAAATGTTGTGGATTATTTCACAGAGGTTGAACAAGTGGCCTTCTCTCCTGCTACTGTTGTTCCTGGAATTGGATTGAGTCCTGATAAG
CTATTGCAAGGAAGA
TTATTAATTTATGATTATACTCAAATTCATCGTATTGGTCCAAACTTTAAGCAACTCTATGTCAATCGTCCACATGGCATTGAACCAATGAATAATTACCTGGGTGGTAACATGTACATT
CCAATCAATGATTCCTTCCCTCACTATACTGGAAGTGCCTTTGGAGGTTTGAAACCAAATGCCAAATACATTGATCCACCATTTAAGGTTACTGGAAATTGTGGTCTGTATGAAGTTCCA
AATGAAGGTTCTTTCGAGGATTTGTATTCTCAAGTTGCTGATTTCTGGAAGATTCTCCCAGAGAAGGATAAGAATAATTTGTGTGATAATATTGCTGCCAGCTTCTTTAGAGTGACTGAA
CAAAGAGTGATTGATAAAATGTTGCAACACTTTGCTCAATGTGATCAACAATGGGCTCAAATTATTCAGACCAAATTGAAGGAGAGAAGAGAAGGCAAATGGATGAGTGAGAGTGAAAAG
GTCTGTATGAATTATGCTCAACAATTATTGACCATGACTCGTCGAGAAGCTCTTTAA

Retrieve as FASTA