Entry information : OsPrx99 (Os07g06175)
Entry ID 1109
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-04 (Christophe Dunand)
Peroxidase information: OsPrx99 (Os07g06175)
Name (synonym) OsPrx99 (Os07g06175)
Class Class III peroxidase    [Orthogroup: Prx229]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx99
start..stop
S start..stop
OsPrx08 621 0 1..345 1..340
OsPrx[P]99-2 607 0 54..348 1..295
OsPrx[P]99-1 607 0 54..348 1..295
BdiPrx61 489 2e-175 1..346 1..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3043594..3043818 225 N° 2 3045494..3046315 822  
join(3043594..3043818,3045494..3046315)


exon

Literature and cross-references OsPrx99 (Os07g06175)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q69QL4
DNA ref. GenBank:   NC_008400.1 (3043594..3046312)
Protein sequence: OsPrx99 (Os07g06175)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37412.95 (35027.7)  
PI (pH):   %s   5.43 (5.42) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLTVAIVCAMATALLAAAPSSAEAGDGELKVGYYDNKCSGVEDIVRSHVIKAIIQDRGIGGSLIRLIFHDCFVRGCDGSVLLNASDENPRPETAAPVSIGLEGFDILEEIKADLERRCPGVVSCADILIFAARDASSILSNGRVRFDVPAGRLDGVVSSAYEAQAELPDPTFTIRQLIDNFARKNFTVEELVVLSGAHSVGDGHCSSFTARLAAPPDQITPSYRNLLNYRCSRGGGADPAVVNNARDEDLATVARFMPAFVGKLRPVSALDNTYYRNNLDKVVNFNSDWQLLTQDEARGHVREYADNAALWDHDFAASLLKLSKLPMPVGSKGEIRNKCGAINHSKS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACGGTAGCAATTGTCTGTGCCATGGCGACCGCGCTTCTCGCCGCCGCCCCGTCGTCGGCGGAGGCCGGCGACGGCGAGCTGAAGGTGGGCTACTACGACAACAAATGCAGC
GGCGTCGAGGACATCGTCAGGTCGCACGTCATCAAGGCTATCATACAGGACCGCGGCATAGGCGGCTCCCTCATCCGTCTCATCTTCCATGATTGTTTTGTCAGG
GTATATTTTGTTTCT
TCCTCCGTTTAATAATGTAAGTCATTCTATCATTTCTCACATTCATATTAATGTTAATGAATCTAGATATATACATTTCCTATCTAGATTCATTAACATCAATATGAATATGGGAAATGA
TAGAATGACTTACATTGTGTAACGGAGTGAGTACATATCGGTACTTCATCTATTTCATATTATAAATTGTTTCGGGTTTTAAATGGATTTATGAGTGAATTCATTTATATTACCTCTATT
TCTCATTATAAGTCATTCTATTTTTTTTCCTAGTCAAACTTTCAATTTATAGAAAAATATAGTAACTTTTTCAGCACAAAGAAAATATTATATTATCAAAATGTATTAAATGTTAATCTT
AATGATATTAATTTGGTGTTGTAAATGTTGCTAAAATTTTTCATAAACTTAATCAAACTTAAAAAGGTTTGAAAAAAAATTAAAATGAGTTATAATACTCTCTCCATCATATTCCAAATC
TAAAAAATTTACTTTTGATAGGCATATTTCAATCCAACCACCTATTTTTTTAATGACTTTCTTGGATTTCATGGGGGTGGCTAATTGGCGCGCGCCCGCCTGTTGGCCCCGGCCCGGAAG
CCCATCAGGCTTCTTTTTTTCTTTTTTTTCGCAAGATTTTTTTGCGATTTTTTTGCCTTTTTCTTTTATCTTTTTTTCGCTTTTGTCTTATTACTTTTTTAATCTTTAGCACACATATTT
TTTCAAAAAATGTTTTGAGTTGAAAATTTTTAAATCTTTAACTTGAAAATTTTAAATTTTGATTTGAAAGTTATCAAATCTTAAGTTGAAAGTTTTCGAATATGAGTTGAAAGTTTTTAA
TCTCAAGTTGAAAACTTTTAAATCTGAGTTGAAAGTTTTCAAATCAGAGTTGAAAGTTTTCAAGTCGAAGTTGAAAGTTTTCAAATCTGGGTTGAAAATTTTTCAAATTTAAGATGAAAA
GTTGAAAGTTCCAAAATTTGACTTTAAAAAATTTAAATTTTGAGTTAAAAGTTTTTAAATCTGGGTTGAAAATTTTCAAATCTAGATTGAAAGTTTCAAATTTTGAGTGGAAAGTTTTTA
AATTTGAGATGAAAGTTTTCAAATATGGATTGAAAACGTTTCAAATTTGAATTGAAAGTATTCAAATATCAGTTAAAAGTTTAAAATTTTGAGTTCAAAGTAATAACACAAAAATAGAAA
ATAACTAAAAAAACAAAACGTGAAAAAAAAGGGAAAAAGATGTGGGCCTAACAGAAAAAACACAAACGACGAGTCCTTTCTCAATAAAAAAAGTGCGCGCTATTTGCTTAACTCGCGCAG
CTTTTCCGGAATTTAATGCGTGACTCTCCATTCTTCCACGCAATATTGGCTATATAGGCATCGAGAAATGTAAATATATTAATAAATCGCTTGTTTACGAGAAATAACTAGTAGCATATT
TAAATGGATGATAAGTAAAATTACTTATCTTTGATCGGTGTATTAAGATAAAATATAACTATAAAAAGTAATGAAGGGAGTACGAAACAGAGGACCAAAACAACTTATATAGTGAAAAGG
AGTAGTAGTTTTGAAGCACTAAGGAGGTACTAGTAGCTTTGAAGCACTTGGGACTAATGAGTGGTTGCACAATGCATGCATGCATGCATGAGTATTGCAGGGTTGCGATGGTTCCGTCCT
CCTTAACGCGTCCGACGAGAACCCTCGTCCTGAGACGGCAGCGCCGGTGAGCATCGGGCTGGAAGGATTCGACATCCTGGAGGAGATCAAGGCCGATCTCGAGAGGAGGTGCCCCGGCGT
GGTCTCCTGCGCCGACATCCTCATCTTCGCCGCCCGCGACGCCAGCAGCATCCTCAGCAACGGCCGCGTCCGCTTCGACGTCCCCGCGGGCCGCCTCGACGGCGTCGTCTCCTCCGCCTA
CGAGGCCCAGGCGGAGCTCCCGGATCCCACCTTCACCATCCGGCAGCTCATCGACAACTTCGCCCGCAAGAACTTCACCGTCGAGGAGCTCGTCGTCCTCTCCGGCGCGCACTCCGTCGG
CGACGGCCACTGCTCCTCCTTCACCGCCCGCCTCGCCGCGCCGCCCGACCAGATCACCCCGTCCTACCGCAACCTGCTCAACTACAGGTGCTCCCGCGGCGGCGGCGCCGACCCTGCGGT
GGTGAACAACGCCCGCGACGAGGACCTCGCCACCGTGGCGAGGTTCATGCCGGCGTTCGTCGGCAAGCTGCGGCCGGTCAGCGCCCTGGACAACACCTACTACCGCAACAACCTCGACAA
GGTGGTCAACTTCAACTCGGACTGGCAGCTGCTGACGCAGGACGAGGCGCGCGGCCACGTCCGCGAGTACGCCGACAACGCCGCCCTCTGGGACCACGACTTCGCCGCCTCGCTGCTCAA
GCTCAGCAAGCTGCCCATGCCGGTGGGGAGCAAGGGGGAGATCAGGAACAAGTGCGGCGCCATCAACCACAGCAAGAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACGGTAGCAATTGTCTGTGCCATGGCGACCGCGCTTCTCGCCGCCGCCCCGTCGTCGGCGGAGGCCGGCGACGGCGAGCTGAAGGTGGGCTACTACGACAACAAATGCAGC
GGCGTCGAGGACATCGTCAGGTCGCACGTCATCAAGGCTATCATACAGGACCGCGGCATAGGCGGCTCCCTCATCCGTCTCATCTTCCATGATTGTTTTGTCAGG
GGTTGCGATGGTTCC
GTCCTCCTTAACGCGTCCGACGAGAACCCTCGTCCTGAGACGGCAGCGCCGGTGAGCATCGGGCTGGAAGGATTCGACATCCTGGAGGAGATCAAGGCCGATCTCGAGAGGAGGTGCCCC
GGCGTGGTCTCCTGCGCCGACATCCTCATCTTCGCCGCCCGCGACGCCAGCAGCATCCTCAGCAACGGCCGCGTCCGCTTCGACGTCCCCGCGGGCCGCCTCGACGGCGTCGTCTCCTCC
GCCTACGAGGCCCAGGCGGAGCTCCCGGATCCCACCTTCACCATCCGGCAGCTCATCGACAACTTCGCCCGCAAGAACTTCACCGTCGAGGAGCTCGTCGTCCTCTCCGGCGCGCACTCC
GTCGGCGACGGCCACTGCTCCTCCTTCACCGCCCGCCTCGCCGCGCCGCCCGACCAGATCACCCCGTCCTACCGCAACCTGCTCAACTACAGGTGCTCCCGCGGCGGCGGCGCCGACCCT
GCGGTGGTGAACAACGCCCGCGACGAGGACCTCGCCACCGTGGCGAGGTTCATGCCGGCGTTCGTCGGCAAGCTGCGGCCGGTCAGCGCCCTGGACAACACCTACTACCGCAACAACCTC
GACAAGGTGGTCAACTTCAACTCGGACTGGCAGCTGCTGACGCAGGACGAGGCGCGCGGCCACGTCCGCGAGTACGCCGACAACGCCGCCCTCTGGGACCACGACTTCGCCGCCTCGCTG
CTCAAGCTCAGCAAGCTGCCCATGCCGGTGGGGAGCAAGGGGGAGATCAGGAACAAGTGCGGCGCCATCAACCACAGCAAGAGCTAA

Retrieve as FASTA