Entry information : OsPrx100
Entry ID 1110
Creation 2005-07-21 (Filippo Passardi)
Last sequence changes 2010-08-04 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-04 (Christophe Dunand)
Peroxidase information: OsPrx100
Name OsPrx100
Class Class III peroxidase    [Orthogroup: Prx071]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx100
start..stop
S start..stop
OsPrx101 643 0 1..316 1..316
OsiPrx07 598 0 1..316 1..317
OsPrx07 575 0 1..316 1..308
BdiPrx60 416 2e-147 4..316 7..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3048607..3048807 201 N° 2 3048988..3049737 750  
join(3048607..3048807,3048988..3049737)


exon

Literature and cross-references OsPrx100
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6Z121
DNA ref. GenBank:   NC_008400.1 (3048607..3049734)
Protein sequence: OsPrx100
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (296)
PWM (Da):   %s   32781.3 (30632.1)  
PI (pH):   %s   5.68 (5.31) Peptide Signal:   %s   cut: 21 range:21-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLILMVAFQAMSLISISTASLQYNFYGSSCPNAEQTISNVVYGLIDADPSMAPALLRLHFHDCFVMGCDASILLDPTKANGSPEKTAIPLRGYDAVNKIKAAVEAVCPGKVSCADILAFAARDSVAKSGGFVYPVPAGSRDGNVSSAFSVFSSIPSPFFDAGELVQSFAAKGLTVDDLVALSGAHSIGTAHCSGFKNRLYPTVDASLDASYAAALRAACPDGSAADDGVVNNSPVSPATLGNQYFKNALAGRVLFTSDAALLTGQNDTAEKVRENAGDLTAWMARFAASMVKMGGIEVLTGARGEVRRFCNVTNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1). No EST. Incorrect prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTAATTCTCATGGTAGCCTTCCAGGCTATGAGCCTCATCTCCATATCAACTGCAAGTCTGCAGTACAATTTCTACGGCTCGTCGTGCCCAAATGCCGAGCAGACGATCAGCAAT
GTCGTCTACGGCTTGATCGATGCTGACCCTTCCATGGCCCCGGCGCTGCTGCGTTTGCATTTCCATGATTGCTTTGTCATG
GTAATGTAATTGCTAACCACAAGTTAATTTAGTTTTTCA
ACTATGAATTGATAGCAGTTTTAATTTCTCACAAGATATATTACTGCAAGCAAAGCTTAGATATTGATGGTTAATTACTTCATTTTGTCCCCAAAAAAAATGTAAACGAAGTTTTTTTTT
TTTTGTTTTTTGATCATGCAGGGTTGTGATGCGTCCATCCTTCTTGATCCCACGAAGGCAAACGGCTCGCCGGAGAAGACAGCGATCCCGCTCCGCGGGTACGACGCCGTGAACAAGATC
AAGGCGGCCGTCGAGGCCGTCTGCCCCGGCAAGGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCCCGCGACTCGGTGGCCAAGTCCGGCGGCTTCGTCTACCCGGTCCCCGCCGGCAGC
CGCGACGGCAACGTGTCGTCCGCCTTCTCCGTCTTCTCCAGCATCCCGTCGCCGTTCTTCGACGCCGGGGAGCTCGTCCAGAGCTTCGCCGCCAAGGGGCTCACCGTCGACGACCTGGTG
GCGCTCTCGGGTGCGCACTCCATCGGCACCGCGCACTGCTCCGGGTTCAAGAACCGGCTGTACCCGACGGTGGACGCGTCCCTGGACGCGAGCTACGCGGCGGCGCTGAGGGCGGCGTGC
CCTGACGGCAGCGCCGCCGACGACGGCGTGGTGAACAACAGCCCCGTGTCGCCGGCGACGCTGGGCAACCAGTACTTCAAGAACGCGCTCGCCGGGCGGGTGCTGTTCACGTCGGACGCG
GCGCTGCTGACCGGCCAGAACGACACGGCGGAGAAGGTCAGGGAGAACGCCGGCGACCTGACCGCGTGGATGGCGCGGTTTGCGGCGTCGATGGTGAAGATGGGCGGCATCGAGGTGCTC
ACCGGGGCGCGGGGGGAGGTCAGGAGGTTCTGCAACGTCACCAACAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTAATTCTCATGGTAGCCTTCCAGGCTATGAGCCTCATCTCCATATCAACTGCAAGTCTGCAGTACAATTTCTACGGCTCGTCGTGCCCAAATGCCGAGCAGACGATCAGCAAT
GTCGTCTACGGCTTGATCGATGCTGACCCTTCCATGGCCCCGGCGCTGCTGCGTTTGCATTTCCATGATTGCTTTGTCATG
GGTTGTGATGCGTCCATCCTTCTTGATCCCACGAAGGCA
AACGGCTCGCCGGAGAAGACAGCGATCCCGCTCCGCGGGTACGACGCCGTGAACAAGATCAAGGCGGCCGTCGAGGCCGTCTGCCCCGGCAAGGTCTCCTGCGCCGACATCCTCGCCTTC
GCCGCCCGCGACTCGGTGGCCAAGTCCGGCGGCTTCGTCTACCCGGTCCCCGCCGGCAGCCGCGACGGCAACGTGTCGTCCGCCTTCTCCGTCTTCTCCAGCATCCCGTCGCCGTTCTTC
GACGCCGGGGAGCTCGTCCAGAGCTTCGCCGCCAAGGGGCTCACCGTCGACGACCTGGTGGCGCTCTCGGGTGCGCACTCCATCGGCACCGCGCACTGCTCCGGGTTCAAGAACCGGCTG
TACCCGACGGTGGACGCGTCCCTGGACGCGAGCTACGCGGCGGCGCTGAGGGCGGCGTGCCCTGACGGCAGCGCCGCCGACGACGGCGTGGTGAACAACAGCCCCGTGTCGCCGGCGACG
CTGGGCAACCAGTACTTCAAGAACGCGCTCGCCGGGCGGGTGCTGTTCACGTCGGACGCGGCGCTGCTGACCGGCCAGAACGACACGGCGGAGAAGGTCAGGGAGAACGCCGGCGACCTG
ACCGCGTGGATGGCGCGGTTTGCGGCGTCGATGGTGAAGATGGGCGGCATCGAGGTGCTCACCGGGGCGCGGGGGGAGGTCAGGAGGTTCTGCAACGTCACCAACAGCTAA

Retrieve as FASTA