Entry information : TmelPrxV
Entry ID 11114
Creation 2012-06-05 (Christophe Dunand)
Last sequence changes 2012-06-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-06-05 (Christophe Dunand)
Peroxidase information: TmelPrxV
Name TmelPrxV
Class Atypical 2-Cysteine peroxiredoxin (type V)    [Orthogroup: PrxV001]
Taxonomy Eukaryota Fungi Ascomycota Pezizomycetes Tuberaceae Tuber
Organism Tuber melanosporum    [TaxId: 39416 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TmelPrxV
start..stop
S start..stop
VdaPrxV01 149 3e-46 27..185 22..183
TadPrxV 139 2e-42 3..188 5..179
BbePrxV 134 3e-40 4..184 1..186
SjapPrxV01 125 4e-37 34..188 1..155
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 125171..125324 154 N° 2 125397..125465 69 N° 3 125535..125638 104 N° 4 125722..125926 205
N° 5 126005..126042 38  
join(125171..125324,125397..125465,125535..125638,125722..125926,126005..126042)


exon

Literature and cross-references TmelPrxV
Protein ref. UniProtKB:   D5GCN2
DNA ref. JGI genome:   scaffold_218 (125171..126042)
Cluster/Prediction ref. JGI gene:   3094
Protein sequence: TmelPrxV
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   189
PWM (Da):   %s   20474.7  
PI (pH):   %s   8.47
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSLLRPWTIAFPSTHRRLSTASIHGFRASLGAFIEVGDLVPNIQLRENTPGKRVSIAEELKGKKKALILGVPGAFSPACSAAHIAKYIEAKFDVPTYVVAINDPFVTAWKDSLTSRDDENFRFLADPSSEFTDAVGMKFDATPIFGGPRSKRYALIVEDGKVSKVFAEPDNTGVSVTSADNILPELK

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCTCTACTCCGTCCCTGGACTATTGCTTTTCCAAGTACCCATCGTCGTCTTTCTACTGCTTCTATTCATGGTTTTCGCGCGTCGCTTGGGGCTTTCATTGAGGTTGGTGACTTG
GTTCCCAATATTCAATTGAGAGAAAATACGCCAG
GTGGGTTACTTGGTGCATCATCATGAATCACACAATTCAGCAGCCTATATTTACTTTTATTGTCTACACTAGGCAAGAGGGTCTCT
ATTGCCGAAGAACTCAAGGGTAAAAAGAAAGCCCTTATTCTTGGAGTTCCCGGTG
GTATATTATCAAATTCTTGAAGAGTACTTCTGAATTGCCATAGACACTAACTTTCTTTGGTTTCA
TCAGCATTTTCTCCTGCTTGCAGTGCGGCGCACATCGCCAAATATATAGAAGCTAAATTTGATGTTCCGACCTATGTTGTGGCTATCAACGACCCCTTTGTCACAAAGGTCAGTTTGGCT
GCCTGGCTCTATCGCTCTGTTCTTGTAGGTGGAGTTAGACCGTTAAAATTCGCGGCATCCGATACGTGTAGGCATGGAAGGACTCCCTCACCTCTCGTGATGATGAGAACTTCCGCTTTC
TGGCTGACCCTTCCTCTGAGTTCACCGACGCTGTTGGCATGAAGTTTGATGCAACCCCTATATTTGGTGGGCCCAGGAGTAAGAGATATGCCCTCATCGTTGAAGATGGAAAAGTGTCAA
AGGTGTTTGCTGAACCCGACAATACTGGGGTCTCGG
GTGAGTGCTGATATCACATATAAACCATCTCTTAGGCGATACGCCGCGGTGCGATAAGGTCTAACTATCCTTGTACAGTTACAT
CTGCCGACAATATCCTTCCAGAGCTCAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCTCTACTCCGTCCCTGGACTATTGCTTTTCCAAGTACCCATCGTCGTCTTTCTACTGCTTCTATTCATGGTTTTCGCGCGTCGCTTGGGGCTTTCATTGAGGTTGGTGACTTG
GTTCCCAATATTCAATTGAGAGAAAATACGCCAG
GCAAGAGGGTCTCTATTGCCGAAGAACTCAAGGGTAAAAAGAAAGCCCTTATTCTTGGAGTTCCCGGTGCATTTTCTCCTGCTTGC
AGTGCGGCGCACATCGCCAAATATATAGAAGCTAAATTTGATGTTCCGACCTATGTTGTGGCTATCAACGACCCCTTTGTCACAAAG
GCATGGAAGGACTCCCTCACCTCTCGTGATGAT
GAGAACTTCCGCTTTCTGGCTGACCCTTCCTCTGAGTTCACCGACGCTGTTGGCATGAAGTTTGATGCAACCCCTATATTTGGTGGGCCCAGGAGTAAGAGATATGCCCTCATCGTTGAA
GATGGAAAAGTGTCAAAGGTGTTTGCTGAACCCGACAATACTGGGGTCTCGG
TTACATCTGCCGACAATATCCTTCCAGAGCTCAAGTAA

Retrieve as FASTA