Entry information : MpiCcP01
Entry ID 11121
Creation 2012-06-06 (Christophe Dunand)
Last sequence changes 2012-06-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-06-06 (Christophe Dunand)
Peroxidase information: MpiCcP01
Name MpiCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella pini (Dothistroma septosporum )    [TaxId: 64363 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MpiCcP01
start..stop
S start..stop
CfulCcP01 592 0 1..322 1..322
ZcelCcP01 536 0 6..322 7..321
BcomCcP 521 0 1..322 1..320
MvarCcP02 499 5e-180 1..322 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1031374..1031543 170 N° 2 1031657..1032037 381 N° 3 1032090..1032507 418  
join(1031374..1031543,1031657..1032037,1032090..1032507)


exon

Literature and cross-references MpiCcP01
DNA ref. JGI genome:   scaffold_4 (1031374..1032507)
Cluster/Prediction ref. JGI gene:   108776
Protein sequence: MpiCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   35793.51  
PI (pH):   %s   4.93
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPPGDYASVRKDIAALLNQPEYDDGSAGPVLVRLAWHSAGTYDAGTDTGGSNGAGMRYEAEGGDPANAGLQHARVFLEPVKERYPWITYADLWTLAGVEAIKQMGGPEIPWQPGRTDYVDDSKLPSRGRLPDGALGGDHLRHIFYRMGFNDQEIVALSGAHNLGRCHADRSGFDGAWVNNPTRFSNTYFKLMLTRDWRVKILDNGVRQFVYYDEDAEEELMMLPSDLALLGDQSFRSWVELYGEDKERFFEDFANVFAKLMELGIKRDDSGKITNTDNALGGYHSAPKKPAHPGKEDGVDRYGEADPLKKQNQEHQIRARL

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Incorrect prediction from JGI (last 30 AA are missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCACCAGGCGACTACGCCTCTGTCCGCAAAGACATCGCCGCGCTCCTCAATCAACCGGAGTATGACGACGGCAGCGCAGGCCCGGTCCTCGTCCGCCTGGCCTGGCACAGTGCA
GGAACATACGACGCCGGGACAGACACTGGCGGCTCAAACGGAGCGGGCAT
GTGAGTAAGATCAGGTACAGTAGCCGTGGTGCGACATCTGAGACACGCTCAGAACGTCAAGGGCTTCTGA
CCGCTCATCTTGAGACACATAGGCTGACCTACCTTACTGTTAGGCGATATGAAGCAGAGGGAGGAGATCCAGCAAACGCGGGCCTCCAGCACGCTCGCGTCTTCCTGGAGCCGGTCAAGG
AGAGATATCCGTGGATTACATATGCAGATTTGTGGACATTGGCAGGAGTCGAAGCGATCAAGCAGATGGGAGGTCCGGAGATACCATGGCAACCAGGTAGGACGGATTATGTTGATGACA
GTAAGCTGCCGAGCAGAGGCAGACTACCGGATGGGGCGTTGGGAGGGGACCACTTGCGACACATCTTTTACAGGATGGGTTTCAATGATCAGGAAATAGTTGCCCTGAGTGGGGCACACA
ACCTCGGGAGATGTCATGCAGACCGCAGTGGATTCGATGGAGCATGGGTGAACAATCCGACCAG
GTAAGCTATTTGTGCCGTTGTAGCCAGGCTACAGAGACTCACTTCCCACCAGATTT
TCCAACACTTACTTCAAGCTCATGCTCACTCGCGACTGGCGCGTGAAGATCCTTGACAACGGCGTCAGACAGTTTGTCTATTACGACGAAGACGCCGAAGAAGAGCTGATGATGCTGCCC
TCCGATTTAGCCTTGCTAGGAGACCAGAGCTTCCGATCGTGGGTGGAACTATATGGTGAGGACAAAGAGAGGTTCTTCGAGGACTTCGCAAACGTATTTGCCAAACTCATGGAGCTTGGC
ATCAAAAGGGACGACAGCGGAAAGATTACGAACACCGACAATGCCCTTGGTGGCTACCACTCTGCACCGAAGAAGCCCGCGCATCCTGGGAAGGAGGATGGTGTGGATCGTTATGGCGAG
GCAGATCCGCTCAAGAAACAGAATCAGGAGCACCAGATCAGAGCGAGGCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCACCAGGCGACTACGCCTCTGTCCGCAAAGACATCGCCGCGCTCCTCAATCAACCGGAGTATGACGACGGCAGCGCAGGCCCGGTCCTCGTCCGCCTGGCCTGGCACAGTGCA
GGAACATACGACGCCGGGACAGACACTGGCGGCTCAAACGGAGCGGGCAT
GCGATATGAAGCAGAGGGAGGAGATCCAGCAAACGCGGGCCTCCAGCACGCTCGCGTCTTCCTGGAGCCG
GTCAAGGAGAGATATCCGTGGATTACATATGCAGATTTGTGGACATTGGCAGGAGTCGAAGCGATCAAGCAGATGGGAGGTCCGGAGATACCATGGCAACCAGGTAGGACGGATTATGTT
GATGACAGTAAGCTGCCGAGCAGAGGCAGACTACCGGATGGGGCGTTGGGAGGGGACCACTTGCGACACATCTTTTACAGGATGGGTTTCAATGATCAGGAAATAGTTGCCCTGAGTGGG
GCACACAACCTCGGGAGATGTCATGCAGACCGCAGTGGATTCGATGGAGCATGGGTGAACAATCCGACCAG
ATTTTCCAACACTTACTTCAAGCTCATGCTCACTCGCGACTGGCGCGTG
AAGATCCTTGACAACGGCGTCAGACAGTTTGTCTATTACGACGAAGACGCCGAAGAAGAGCTGATGATGCTGCCCTCCGATTTAGCCTTGCTAGGAGACCAGAGCTTCCGATCGTGGGTG
GAACTATATGGTGAGGACAAAGAGAGGTTCTTCGAGGACTTCGCAAACGTATTTGCCAAACTCATGGAGCTTGGCATCAAAAGGGACGACAGCGGAAAGATTACGAACACCGACAATGCC
CTTGGTGGCTACCACTCTGCACCGAAGAAGCCCGCGCATCCTGGGAAGGAGGATGGTGTGGATCGTTATGGCGAGGCAGATCCGCTCAAGAAACAGAATCAGGAGCACCAGATCAGAGCG
AGGCTGTGA

Retrieve as FASTA