Entry information : ManiAPx-CcP
Entry ID 11124
Creation 2012-06-06 (Christophe Dunand)
Last sequence changes 2012-06-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: ManiAPx-CcP
Name ManiAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Clavicipitaceae Metarhizium
Organism Metarhizium anisopliae    [TaxId: 5530 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ManiAPx-CcP
start..stop
S start..stop
MacrAPx-CcP01 1691 0 1..904 1..909
EfeAPx-CcP_F11 1375 0 1..892 1..878
EfeAPx-CcP_F11 231 3e-64 572..794 673..890
TaspAPx-CcP01 1269 0 19..890 19..907
TviAPx-CcP01 1247 0 1..890 1..904
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 296109..297987 1879 N° 2 295193..296028 836  
complement(join(295193..296028,296109..297987))


exon

Literature and cross-references ManiAPx-CcP
Protein sequence: ManiAPx-CcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   904 (885)
PWM (Da):   %s   95418.51 (93595.5)  
PI (pH):   %s   5.05 (4.99) Peptide Signal:   %s   cut: 20 range:20-904
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTSPVLLGLLSLAGSALADPTWPSSIDELEEIMYQINSFRARKFADTVNPCTNEASGPGRRNAAEWLRSAFHDMSTANTFFKTGGLDGSLQYELDNGENTGPGHRTTMNFMGPYVTRRSSLSDLLAMGVYMSVRSCGGPIIPIRAGRIDATAAGALGVPQPQNSATMFQQQFERMGFSTEEMIQATACGHTLGGVHQDEFPDLMPATGVVSGNVALDSTDAVFDNKVVTEYLSGNTTNMLVVGPSVRINKNSDFKVFNVDGNKTMETLTDANNFKAVCQKVLQKMIEVVPPTVTLTDPIVPYTVKPVNLQLTLTNGGTGLQFTGFIRVKVTDLAKDSIKNVAITYKDRKGNANCGASACTITSTVQGVAQGFDDNFNFYPIEAVIPAASGISSFTVTVNNADGTSKAYDNNGNGYPLQDDILFQAPQSCVTGSSGALTVVAAVRNDVASNGAQASITYKTPQTNSPVALLNNATVPLQKGACLGKYTLFSGQYTIPGGMPYQSRVDVISGSKADTFKAITDIGGTCTAFPNPGACDAVDPPVNSTTTTTTPGSTATTTTTTSIVAPVTPTHRATVAGYTHVSCWSEGVGVRALAGTSFANDTMTLEKCADYCKAYVYWGTEYGRECYCGNALDKTSAAAALTECNMACGGDPSAYCGAGNRLELYSTTSAPVTPTPTATLSHKPTVAPYTMVGCWSEGNGVRALGQAATTSDKMTNEACATFCKSFKYFGTEYGSECYCGSFLADSSKTAPIGECNMPCSGDQYEYCGASSRLELYQNPNITTGNPEQPAAVGDYVFAGCQTEGNNTRALDGPTLPQNNMTNEVCATFCNSNGNNFTYFGTEYGRECYCGNALAASSAVAPAADCRMLCGGSDTEYCGASNRLSVYKKKQIPATTQKRRRNYL

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Peroxidase domain fused to 3 WSC domains (putative carbohydrate binding domain).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCACCTGTGTTGCTAGGCCTTCTCAGCCTGGCTGGCTCAGCCTTGGCTGATCCGACCTGGCCCTCCAGCATCGACGAATTGGAGGAGATTATGTATCAAATCAACTCTTTC
CGGGCTCGCAAATTTGCTGATACTGTCAACCCATGCACCAACGAAGCCTCGGGTCCCGGTCGCCGCAATGCTGCAGAGTGGCTACGATCCGCCTTCCACGACATGTCAACGGCCAACACC
TTCTTCAAGACTGGTGGTCTAGATGGTTCCCTGCAGTATGAGTTGGACAATGGTGAGAACACAGGTCCGGGCCATAGAACGACCATGAATTTCATGGGACCTTATGTCACTCGCCGTTCT
AGTCTCTCTGACTTGCTTGCCATGGGGGTCTATATGTCTGTTCGTTCATGCGGCGGCCCAATCATTCCCATTCGCGCTGGACGTATAGATGCTACCGCCGCCGGTGCCTTGGGTGTTCCC
CAGCCTCAGAACTCGGCAACCATGTTCCAACAGCAGTTTGAACGCATGGGTTTCAGTACTGAGGAAATGATTCAGGCTACGGCCTGCGGCCACACTCTTGGTGGCGTTCATCAAGACGAA
TTTCCTGATCTCATGCCAGCTACTGGTGTAGTCAGTGGCAATGTAGCACTCGATTCTACTGATGCCGTCTTTGACAACAAAGTCGTTACTGAATACCTCTCTGGAAACACCACCAACATG
CTCGTCGTCGGCCCCTCGGTCAGGATTAACAAGAACTCGGACTTCAAGGTTTTCAATGTCGACGGAAACAAGACCATGGAGACTTTGACTGACGCCAACAATTTCAAGGCCGTCTGCCAA
AAGGTCCTTCAAAAGATGATTGAGGTGGTTCCTCCAACCGTCACCCTTACCGACCCAATTGTCCCCTACACCGTCAAGCCTGTCAACTTGCAGCTTACTCTGACTAACGGCGGCACTGGT
CTTCAATTTACCGGGTTCATTCGTGTCAAGGTCACTGATCTCGCAAAGGACAGCATCAAGAACGTGGCCATCACTTACAAGGACCGCAAGGGCAATGCAAACTGTGGTGCGAGCGCTTGC
ACCATCACGAGCACTGTTCAGGGAGTTGCGCAAGGCTTCGACGACAACTTTAACTTTTACCCCATCGAGGCCGTCATTCCTGCTGCGTCGGGCATCTCGTCCTTCACAGTCACCGTGAAC
AATGCCGACGGAACAAGCAAAGCCTACGACAACAACGGCAACGGCTATCCTCTTCAGGATGATATCTTGTTCCAGGCCCCTCAGAGCTGTGTCACTGGCAGCTCTGGCGCCCTTACCGTT
GTCGCTGCTGTTCGCAATGATGTTGCCAGCAATGGCGCCCAGGCTAGCATTACCTACAAAACGCCGCAGACCAACAGTCCCGTGGCCCTCTTAAACAATGCCACTGTCCCTCTTCAGAAA
GGCGCCTGTCTTGGCAAGTATACCCTTTTCTCGGGCCAGTACACCATTCCCGGTGGCATGCCTTACCAGTCTCGGGTTGATGTTATTTCTGGAAGCAAAGCCGACACCTTCAAGGCTATC
ACCGATATTGGCGGAACTTGCACCGCCTTTCCAAACCCTGGAGCCTGTGATGCTGTTGACCCTCCAGTTAACTCGACCACCACGACGACAACTCCTGGTTCTACGGCCACGACCACAACC
ACAACTTCGATAGTGGCGCCCGTCACTCCTACCCACCGTGCCACTGTTGCCGGCTATACTCACGTCTCCTGCTGGTCTGAGGGTGTCGGCGTCCGAGCGCTGGCTGGCACCTCTTTCGCC
AACGACACCATGACCCTTGAGAAGTGCGCCGACTACTGCAAAGCTTATGTATACTGGGGTACCGAGTATGGTCGTGAAT
GTAAGCCTCCAACCTAGAAAGCTCATCTCATTTTGGCCTTG
ACAATTCATTGGAATGCAAGTATCTAACTGAGGAATTAGGCTACTGCGGAAATGCTCTTGACAAGACTAGTGCGGCTGCTGCCCTAACTGAATGCAACATGGCCTGCGGCGGTGACCCCA
GCGCGTACTGCGGCGCCGGCAACCGTCTCGAGCTGTACTCGACGACGAGCGCACCCGTTACGCCGACTCCTACTGCCACTCTCAGTCACAAGCCCACTGTGGCCCCGTACACTATGGTCG
GCTGTTGGAGCGAGGGCAACGGCGTCAGGGCTCTTGGACAAGCGGCCACTACTAGTGACAAGATGACCAATGAAGCTTGTGCTACCTTCTGCAAGTCTTTCAAGTATTTCGGCACCGAAT
ACGGCAGTGAATGTTACTGCGGCAGCTTCCTCGCCGATAGCAGCAAGACGGCGCCTATTGGGGAATGCAACATGCCTTGCTCTGGTGATCAGTACGAGTATTGTGGTGCCAGCAGCCGCT
TGGAGCTTTACCAGAACCCCAACATTACCACTGGTAACCCTGAGCAGCCTGCAGCTGTTGGCGACTATGTCTTTGCCGGATGCCAAACTGAGGGCAACAACACGAGAGCTCTGGACGGCC
CGACACTGCCGCAGAATAACATGACCAATGAAGTGTGTGCCACGTTTTGCAATAGCAATGGCAATAACTTCACGTACTTTGGTACTGAGTATGGCCGAGAGTGCTACTGCGGTAACGCTC
TTGCTGCTTCCTCAGCTGTTGCCCCCGCTGCCGATTGCAGAATGCTCTGCGGTGGTAGTGACACGGAGTACTGCGGTGCTAGCAACAGGCTGTCTGTTTATAAGAAGAAGCAGATTCCCG
CCACGACACAGAAGCGGAGACGCAACTACTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACCTCACCTGTGTTGCTAGGCCTTCTCAGCCTGGCTGGCTCAGCCTTGGCTGATCCGACCTGGCCCTCCAGCATCGACGAATTGGAGGAGATTATGTATCAAATCAACTCTTTC
CGGGCTCGCAAATTTGCTGATACTGTCAACCCATGCACCAACGAAGCCTCGGGTCCCGGTCGCCGCAATGCTGCAGAGTGGCTACGATCCGCCTTCCACGACATGTCAACGGCCAACACC
TTCTTCAAGACTGGTGGTCTAGATGGTTCCCTGCAGTATGAGTTGGACAATGGTGAGAACACAGGTCCGGGCCATAGAACGACCATGAATTTCATGGGACCTTATGTCACTCGCCGTTCT
AGTCTCTCTGACTTGCTTGCCATGGGGGTCTATATGTCTGTTCGTTCATGCGGCGGCCCAATCATTCCCATTCGCGCTGGACGTATAGATGCTACCGCCGCCGGTGCCTTGGGTGTTCCC
CAGCCTCAGAACTCGGCAACCATGTTCCAACAGCAGTTTGAACGCATGGGTTTCAGTACTGAGGAAATGATTCAGGCTACGGCCTGCGGCCACACTCTTGGTGGCGTTCATCAAGACGAA
TTTCCTGATCTCATGCCAGCTACTGGTGTAGTCAGTGGCAATGTAGCACTCGATTCTACTGATGCCGTCTTTGACAACAAAGTCGTTACTGAATACCTCTCTGGAAACACCACCAACATG
CTCGTCGTCGGCCCCTCGGTCAGGATTAACAAGAACTCGGACTTCAAGGTTTTCAATGTCGACGGAAACAAGACCATGGAGACTTTGACTGACGCCAACAATTTCAAGGCCGTCTGCCAA
AAGGTCCTTCAAAAGATGATTGAGGTGGTTCCTCCAACCGTCACCCTTACCGACCCAATTGTCCCCTACACCGTCAAGCCTGTCAACTTGCAGCTTACTCTGACTAACGGCGGCACTGGT
CTTCAATTTACCGGGTTCATTCGTGTCAAGGTCACTGATCTCGCAAAGGACAGCATCAAGAACGTGGCCATCACTTACAAGGACCGCAAGGGCAATGCAAACTGTGGTGCGAGCGCTTGC
ACCATCACGAGCACTGTTCAGGGAGTTGCGCAAGGCTTCGACGACAACTTTAACTTTTACCCCATCGAGGCCGTCATTCCTGCTGCGTCGGGCATCTCGTCCTTCACAGTCACCGTGAAC
AATGCCGACGGAACAAGCAAAGCCTACGACAACAACGGCAACGGCTATCCTCTTCAGGATGATATCTTGTTCCAGGCCCCTCAGAGCTGTGTCACTGGCAGCTCTGGCGCCCTTACCGTT
GTCGCTGCTGTTCGCAATGATGTTGCCAGCAATGGCGCCCAGGCTAGCATTACCTACAAAACGCCGCAGACCAACAGTCCCGTGGCCCTCTTAAACAATGCCACTGTCCCTCTTCAGAAA
GGCGCCTGTCTTGGCAAGTATACCCTTTTCTCGGGCCAGTACACCATTCCCGGTGGCATGCCTTACCAGTCTCGGGTTGATGTTATTTCTGGAAGCAAAGCCGACACCTTCAAGGCTATC
ACCGATATTGGCGGAACTTGCACCGCCTTTCCAAACCCTGGAGCCTGTGATGCTGTTGACCCTCCAGTTAACTCGACCACCACGACGACAACTCCTGGTTCTACGGCCACGACCACAACC
ACAACTTCGATAGTGGCGCCCGTCACTCCTACCCACCGTGCCACTGTTGCCGGCTATACTCACGTCTCCTGCTGGTCTGAGGGTGTCGGCGTCCGAGCGCTGGCTGGCACCTCTTTCGCC
AACGACACCATGACCCTTGAGAAGTGCGCCGACTACTGCAAAGCTTATGTATACTGGGGTACCGAGTATGGTCGTGAAT
GCTACTGCGGAAATGCTCTTGACAAGACTAGTGCGGCTGCT
GCCCTAACTGAATGCAACATGGCCTGCGGCGGTGACCCCAGCGCGTACTGCGGCGCCGGCAACCGTCTCGAGCTGTACTCGACGACGAGCGCACCCGTTACGCCGACTCCTACTGCCACT
CTCAGTCACAAGCCCACTGTGGCCCCGTACACTATGGTCGGCTGTTGGAGCGAGGGCAACGGCGTCAGGGCTCTTGGACAAGCGGCCACTACTAGTGACAAGATGACCAATGAAGCTTGT
GCTACCTTCTGCAAGTCTTTCAAGTATTTCGGCACCGAATACGGCAGTGAATGTTACTGCGGCAGCTTCCTCGCCGATAGCAGCAAGACGGCGCCTATTGGGGAATGCAACATGCCTTGC
TCTGGTGATCAGTACGAGTATTGTGGTGCCAGCAGCCGCTTGGAGCTTTACCAGAACCCCAACATTACCACTGGTAACCCTGAGCAGCCTGCAGCTGTTGGCGACTATGTCTTTGCCGGA
TGCCAAACTGAGGGCAACAACACGAGAGCTCTGGACGGCCCGACACTGCCGCAGAATAACATGACCAATGAAGTGTGTGCCACGTTTTGCAATAGCAATGGCAATAACTTCACGTACTTT
GGTACTGAGTATGGCCGAGAGTGCTACTGCGGTAACGCTCTTGCTGCTTCCTCAGCTGTTGCCCCCGCTGCCGATTGCAGAATGCTCTGCGGTGGTAGTGACACGGAGTACTGCGGTGCT
AGCAACAGGCTGTCTGTTTATAAGAAGAAGCAGATTCCCGCCACGACACAGAAGCGGAGACGCAACTACTTGTAA

Retrieve as FASTA