Entry information : SAspAPx01
Entry ID 11129
Creation 2012-06-06 (Christophe Dunand)
Last sequence changes 2012-06-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-08-03 (Christophe Dunand)
Peroxidase information: SAspAPx01
Name SAspAPx01
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Fungi/Metazoa; Choanoflagellida; Choanoflagellida; Choanoflagellida
Organism Salpingoeca sp. (Salpingoeca rosetta)    [TaxId: 946362 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SAspAPx01
start..stop
S start..stop
MbrAPx01 333 6e-115 61..338 9..287
KmAPx01 286 8e-96 61..332 35..328
MpuAPx01 285 4e-95 29..332 5..329
OmarAPx01 276 2e-92 66..338 19..311
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 275082..275672 591 N° 2 274703..274780 78 N° 3 274019..274369 351  
complement(join(274019..274369,274703..274780,275082..275672))


exon

Literature and cross-references SAspAPx01
DNA ref. GenBank:   GL832955.1 (275672..274019)
Protein sequence: SAspAPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   37087.62  
PI (pH):   %s   9.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSERAAVMLRHVEASRKRVGKDSNEGANNSTTTSSSSNNTRRDSAPSTAAVAAATTLSEYREELRKLEKELRTFIDKRNCHPIMLRLAWHDAGTYNRHVPCFPDCGGANGSIRLSPELKHAANAGLEKAVRFLQPFHTKHPMVSWADLIQLAGALAVELAGGPRIPMRYGRIDADVPAEEGKLPDANPASPLDHVRKVFDRLGMTPKETVALIGAHTIGRAFKERSGVTEYGYGNDKGTPHTRSTHVARGDGHAGIGMPGGQSWTSNWLSFDNAFFQQAYKSDKALLWLPTDSAVAKEEYARHFRQFASDNRSFLAAYAPAHKKLSESGSMFAFHVELD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGAGCGAGCCGCTGTGATGCTGCGCCATGTTGAGGCGTCGAGGAAGCGGGTGGGCAAGGACAGCAACGAGGGTGCAAACAACAGCACCACCACCAGCAGTAGCAGCAACAACACA
AGAAGAGATTCGGCACCATCAACTGCTGCGGTGGCAGCAGCAACAACACTCAGTGAATACAGGGAGGAGCTTCGCAAGCTTGAAAAGGAACTCAGGACCTTCATTGACAAACGAAACTGC
CACCCAATCATGCTGCGCTTGGCATGGCATGACGCAGGCACATACAACCGCCATGTCCCCTGCTTTCCAGACTGCGGGGGCGCAAACGGCAGCATCCGGCTGTCCCCTGAGCTGAAGCAC
GCAGCCAACGCGGGCCTTGAAAAGGCGGTCCGCTTCCTTCAACCGTTTCATACAAAGCACCCGATGGTGTCGTGGGCAGATCTCATTCAGCTGGCGGGTGCGCTCGCCGTGGAGCTCGCC
GGCGGCCCGCGTATTCCAATGCGCTACGGCCGTATTGATGCCGATGTACCAGCAGAAGAAGGCAAACTGCCAGACGCCAACCCAGCTTCCCCTCTCGACCACGTTCGGAAG
GTGTGTGCA
TGTGTTTGGGTGGTTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTTATGGTGTGTGGTGCCGTGTGGTGTTTGCATGTGTGTGTGTGTGCGCGTGTGGCTT
GCTTTGCCTGCTGATCGTGACTTCTGTGGTCAGATAAGCCAGCAAGCTGCTGTGTGTCTATGGCGACATGCAGGCCCAATTTTTCGTGTAACTGTGCACCTGAGTTGTGGTCTTACTCTC
ACGACCCGCCCATCCGCTATCGACTCCATCACACCCACCGCACACGCAACAGGTGTTTGATCGACTGGGCATGACGCCCAAGGAAACCGTTGCTCTCATCGGCGCTCACACAATTGGGCG
TGCTTTCAAG
GTGTGGGTACATCGTGTGCGTGTTGATGCTGCTCTCACCCTCGCGATTGCCTTTGTGGAAATAACGCGCGTGAGCCAAAGTGCACGATGAACTGACCACGCGCACGTGAT
GCCGCACTTCCTCTTACACGTGGCCAATGGTGGTCGGAGTTCCTTTCTGTTTTCATTCACGCACACGCACCCACACCCTCACATACACCCTCACATACATATGTTGTTTTCGTTTTCTCT
GTCCATTCCGTACACCCTCACACACACACACATACACACACCATGACACAAACACACACACATGCACACATCATGACACAAACACGTACGCATGTGCACACAGGAGCGCAGCGGCGTCAC
AGAATATGGCTACGGCAACGACAAAGGCACACCACACACACGCTCAACACACGTTGCACGCGGAGATGGACACGCGGGTATTGGTATGCCTGGTGGTCAGTCGTGGACGAGCAACTGGCT
CAGCTTTGACAACGCCTTTTTCCAACAAGCATACAAGTCAGACAAGGCACTGCTCTGGTTGCCAACCGACAGTGCCGTCGCCAAGGAAGAATATGCCAGGCACTTTCGTCAGTTTGCCAG
CGACAACCGCAGCTTTCTCGCTGCATATGCACCGGCCCACAAGAAGCTGTCAGAGTCTGGCTCCATGTTTGCATTCCACGTTGAGCTCGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGAGCGAGCCGCTGTGATGCTGCGCCATGTTGAGGCGTCGAGGAAGCGGGTGGGCAAGGACAGCAACGAGGGTGCAAACAACAGCACCACCACCAGCAGTAGCAGCAACAACACA
AGAAGAGATTCGGCACCATCAACTGCTGCGGTGGCAGCAGCAACAACACTCAGTGAATACAGGGAGGAGCTTCGCAAGCTTGAAAAGGAACTCAGGACCTTCATTGACAAACGAAACTGC
CACCCAATCATGCTGCGCTTGGCATGGCATGACGCAGGCACATACAACCGCCATGTCCCCTGCTTTCCAGACTGCGGGGGCGCAAACGGCAGCATCCGGCTGTCCCCTGAGCTGAAGCAC
GCAGCCAACGCGGGCCTTGAAAAGGCGGTCCGCTTCCTTCAACCGTTTCATACAAAGCACCCGATGGTGTCGTGGGCAGATCTCATTCAGCTGGCGGGTGCGCTCGCCGTGGAGCTCGCC
GGCGGCCCGCGTATTCCAATGCGCTACGGCCGTATTGATGCCGATGTACCAGCAGAAGAAGGCAAACTGCCAGACGCCAACCCAGCTTCCCCTCTCGACCACGTTCGGAAG
GTGTTTGAT
CGACTGGGCATGACGCCCAAGGAAACCGTTGCTCTCATCGGCGCTCACACAATTGGGCGTGCTTTCAAG
GAGCGCAGCGGCGTCACAGAATATGGCTACGGCAACGACAAAGGCACACCA
CACACACGCTCAACACACGTTGCACGCGGAGATGGACACGCGGGTATTGGTATGCCTGGTGGTCAGTCGTGGACGAGCAACTGGCTCAGCTTTGACAACGCCTTTTTCCAACAAGCATAC
AAGTCAGACAAGGCACTGCTCTGGTTGCCAACCGACAGTGCCGTCGCCAAGGAAGAATATGCCAGGCACTTTCGTCAGTTTGCCAGCGACAACCGCAGCTTTCTCGCTGCATATGCACCG
GCCCACAAGAAGCTGTCAGAGTCTGGCTCCATGTTTGCATTCCACGTTGAGCTCGACTGA

Retrieve as FASTA