Entry information : OsPrx103
Entry ID 1113
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx103
Name OsPrx103
Class Class III peroxidase     [Orthogroup: Prx011]*
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx103
start..stop
S start..stop
OsPrx134 361 3e-125 4..337 7..335
SbPrx24 348 6e-120 6..337 14..336
AvePrx109-1B 346 2e-119 25..338 24..327
TaPrx24-1B 343 3e-118 25..337 24..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20729452..20729664 213 N° 2 20729768..20729962 195 N° 3 20730442..20730604 163 N° 4 20730692..20731137 446
join(20729452..20729664,20729768..20729962,20730442..20730604,20730692..20731137 )


exon

Literature and cross-references OsPrx103
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8GVP1
DNA ref. GenBank:   NC_008400.1 (20729452..20731134)
Protein sequence: OsPrx103
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (314)
PWM (Da):   %s   35719.7 (33535.5)  
PI (pH):   %s   5.04 (5.04) Peptide Signal:   %s   cut: 25 range:25-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAIFVVLVAAAAAALVSSSAAQAQLKVGYYGDTCNGAEETVRQEVASVLSVAPYLAGALLRLHFHDCFVRGCDGSILLDSVAGGAVDAEKEAETSAGLRGFDVIDSIKEKLEQACPGTVSCADILALAARDAVHWSNGPFWPVPTGRLDGKISNAAETVDLPPPNSGMAQLQAAFAHKNLTAKDLVVLSGAHTIGFSHCQPFHDRLYNYTGGNRLNDVDPELDPAYLNELRSKCGAAASATANADNPGVMVEISPKRSPKFDTGYYTQVARRRGLFRSDAVLLDDDFTGAYVKKHATGLFDMEFFGDFGEAMVNMGNLQPPPGNDGEVRRKCSVVNY

Retrieve as FASTA  
Remarks chromosome 7. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAATCTTTGTCGTGTTAGTAGCAGCAGCAGCAGCAGCTCTCGTCTCGTCCAGCGCTGCGCAGGCACAGCTCAAAGTTGGGTATTACGGGGACACATGCAACGGCGCAGAAGAG
ACCGTGAGGCAGGAGGTTGCATCTGTTCTATCCGTGGCGCCGTATCTCGCCGGCGCTCTCCTGAGGCTCCATTTCCACGACTGCTTCGTCAGG
GTGAGTAGATACTGAGTTCAGAGATTG
TAGATGAGTAGTAGTGCTTATGCAGTGGTGTTGATATGTGTCAATGTACTCATGTGTGTGCTTGTGATATAAGCAGGGATGCGACGGGTCGATCCTGTTGGACTCGGTGGCCGGCGGCGC
CGTCGACGCCGAGAAAGAAGCTGAAACGAGTGCAGGCCTGAGAGGGTTCGACGTCATCGACAGCATCAAGGAGAAGCTGGAGCAGGCTTGTCCTGGGACTGTTTCGTGTGCTGACATCCT
CGCCCTTGCCGCCAGGGACGCTGTTCATTGG
GTAACTCAGCTATCTTGATGCGACTCAATATCTCAGTTGTTGTGGGACACATTTCGAGCTTAAGGGCATGTTCACTTTGATGTTAAAAA
AAACCTTACCAAATTTTAGCATAACTGTCAAAATTTTGGCAACTTACCAAAATTTTGGTAGGATTTCTTAGATAGTTACCAAATTTTGGTAGCAAACTAAATGTAGCCATTTTTTTTAAG
TAACTTTACCAAAATTTAGTAATGTTGAAAATAACATTAAAGTGAACAGGCCCTAAACCACAATTACCGGCCATTTCCATCCTGCATGCATGCGGCATACAACATCGGGGAAAAAAAAAA
TCCTATAAGGCCATTTCTCTGTTAAAGCTGGCCTAATCAGAAAACGCAGAACTAAAATCTGAAAGCACTCGAGTTTATAGCAACGGCTATGAGATGGAGTACATACAAATATGATGCAAC
TAAATATAATTTTGTGCACTCCTAATTCAGAGTAATGGCCCGTTTTGGCCTGTACCAACTGGGCGGCTCGATGGAAAAATATCGAACGCCGCCGAGACGGTTGATCTCCCGCCACCAAAT
TCAGGCATGGCACAGCTGCAAGCAGCGTTCGCCCATAAGAACTTGACTGCCAAGGATCTCGTCGTCCTATCGG
GTGCAGCTCCGCCACAAGATATCATCAATTATCATCAGATCGACTGC
GGCAATCATCGATCTTAATTACTTAACGTGACCATTCTAGGTGCGCACACCATCGGCTTCTCGCACTGCCAGCCGTTCCACGACCGCCTCTACAACTACACCGGCGGGAACAGGCTCAAC
GACGTCGACCCGGAGCTCGACCCGGCCTACCTCAACGAGCTCCGGTCCAAGTGCGGCGCCGCTGCCAGTGCCACTGCCAACGCCGACAACCCGGGGGTCATGGTGGAGATCTCCCCCAAG
AGATCGCCCAAGTTCGACACGGGCTACTACACGCAGGTCGCGCGGCGCCGCGGGCTGTTCCGGTCCGACGCCGTGCTGCTCGACGACGACTTCACCGGAGCCTACGTCAAGAAGCACGCG
ACGGGGCTCTTTGACATGGAGTTCTTCGGTGACTTCGGCGAGGCCATGGTGAATATGGGGAACCTCCAGCCGCCGCCGGGGAATGATGGCGAGGTCCGGAGGAAGTGCTCCGTCGTCAAT
TACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAATCTTTGTCGTGTTAGTAGCAGCAGCAGCAGCAGCTCTCGTCTCGTCCAGCGCTGCGCAGGCACAGCTCAAAGTTGGGTATTACGGGGACACATGCAACGGCGCAGAAGAG
ACCGTGAGGCAGGAGGTTGCATCTGTTCTATCCGTGGCGCCGTATCTCGCCGGCGCTCTCCTGAGGCTCCATTTCCACGACTGCTTCGTCAGG
GGATGCGACGGGTCGATCCTGTTGGAC
TCGGTGGCCGGCGGCGCCGTCGACGCCGAGAAAGAAGCTGAAACGAGTGCAGGCCTGAGAGGGTTCGACGTCATCGACAGCATCAAGGAGAAGCTGGAGCAGGCTTGTCCTGGGACTGTT
TCGTGTGCTGACATCCTCGCCCTTGCCGCCAGGGACGCTGTTCATTGG
AGTAATGGCCCGTTTTGGCCTGTACCAACTGGGCGGCTCGATGGAAAAATATCGAACGCCGCCGAGACGGTT
GATCTCCCGCCACCAAATTCAGGCATGGCACAGCTGCAAGCAGCGTTCGCCCATAAGAACTTGACTGCCAAGGATCTCGTCGTCCTATCGG
GTGCGCACACCATCGGCTTCTCGCACTGC
CAGCCGTTCCACGACCGCCTCTACAACTACACCGGCGGGAACAGGCTCAACGACGTCGACCCGGAGCTCGACCCGGCCTACCTCAACGAGCTCCGGTCCAAGTGCGGCGCCGCTGCCAGT
GCCACTGCCAACGCCGACAACCCGGGGGTCATGGTGGAGATCTCCCCCAAGAGATCGCCCAAGTTCGACACGGGCTACTACACGCAGGTCGCGCGGCGCCGCGGGCTGTTCCGGTCCGAC
GCCGTGCTGCTCGACGACGACTTCACCGGAGCCTACGTCAAGAAGCACGCGACGGGGCTCTTTGACATGGAGTTCTTCGGTGACTTCGGCGAGGCCATGGTGAATATGGGGAACCTCCAG
CCGCCGCCGGGGAATGATGGCGAGGTCCGGAGGAAGTGCTCCGTCGTCAATTACTAG

Retrieve as FASTA