Entry information : OsPrx104
Entry ID 1114
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx104
Name OsPrx104
Class Class III peroxidase    [Orthogroup: Prx046]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Pannicles
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx104
start..stop
S start..stop
PpePrx14 376 3e-131 33..339 29..328
VvPrx31 370 1e-128 7..339 12..327
LePrx04 367 5e-128 12..339 3..322
NtPrx62-1B 366 2e-127 10..339 6..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20749814..20750047 234 N° 2 20750387..20750578 192 N° 3 20750690..20750870 181 N° 4 20751254..20751666 413
join(20749814..20750047,20750387..20750578,20750690..20750870,20751254..20751666 )


exon

Literature and cross-references OsPrx104
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8GVN8
DNA ref. GenBank:   NC_008400.1 (20749814..20751663)
Protein sequence: OsPrx104
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (311)
PWM (Da):   %s   35840.25 (33017.6)  
PI (pH):   %s   8.48 (8.32) Peptide Signal:   %s   cut: 29 range:29-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQLLAMKLILTTLVVAVLALSAGTATATCDTLTVGHYRQSCRAAETIVRDTVKLYFSKDQTVTAPLLRLHFHDCFVRGCDGSVLLNATAASGPAEKDAMPNQSLDGFYVIDAAKAALEKECPGVVSCADILALAARDAVSMAAGNINGASLWQVPTGRLDGRVSSAAEAVANLPSSFADFAKLKEQFGSKGLNVQDLAILSGAHAIGNSHCVSFAKRLYNFTGKGDADPTLDRAYAAAVLRAACPPRFDNATTVEMVPGSSTTFDTDYYRLVASRRGLFHSDQALLQDREAAATVRVMARSSRQAFFRRFGVSMVRMGNVGVLTGAAGEIRKNCALIN

Retrieve as FASTA  
Remarks chromosome 7. 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAGCTGCTCGCGATGAAGCTGATCCTGACGACGCTCGTCGTCGCCGTGCTGGCGCTGTCCGCCGGCACGGCCACGGCCACCTGCGACACGCTCACGGTCGGGCACTACCGGCAG
TCGTGCCGCGCCGCCGAGACCATCGTGCGCGACACCGTCAAGCTCTACTTCTCAAAGGACCAGACCGTCACCGCGCCGCTGCTCCGCCTCCACTTCCACGACTGCTTCGTCAGG
GTAAAA
ATTACTAGCATATACTCTCTCCGTAAAAAAAAAACTCAACTTATTTGAATTTTATCTCACAAAAACTAACTTCTACCATCTTATTTATCCTCCGTATGTAAAACGAGAAGTTTTATTTCT
TCAATACCCTTTACCCACCCATCACTCTTACTATTTTTATCAATGATTAAGAGTATTTTAGTCATTCTCTATCTCTACTACTTCTATTATTAGATTTATTTTGTAACGGAGGGAGTATAT
CAATTATCAAGAACAAGTTAAGCTATCAGCTTGTAATTGACAGCTGCAAATGTGGATGGAGAACTTACCCAAGTTTAAAATTATTATTGGCAGGGATGTGACGGATCGGTGTTGCTGAAC
GCGACGGCGGCGAGCGGGCCGGCGGAGAAGGACGCGATGCCGAACCAGAGCCTGGACGGGTTCTACGTCATCGACGCCGCCAAGGCGGCGCTGGAGAAGGAGTGCCCCGGCGTCGTCTCC
TGCGCCGACATCCTGGCGCTGGCGGCCAGAGACGCTGTCTCCATG
GTTTGAGACTCGCTCCACTGATGAATTCTCCTGTTACTGTAGAGACGATGAGCAATGCAAAAGCTGATGCTGATC
TGATCATCCGATTCTTGCTGTGCTCTGTCTTTTCAGGCTGCCGGGAACATCAATGGCGCGAGCCTTTGGCAAGTCCCGACGGGGCGGCTCGACGGCCGCGTGTCGTCGGCGGCGGAGGCC
GTGGCCAACCTACCGTCTTCTTTCGCGGATTTCGCTAAGCTCAAGGAGCAGTTCGGTTCCAAGGGCCTAAATGTGCAAGACCTCGCGATCCTATCAG
GTATAGTAGTGCTAACCATGGAC
GATTCTAAAGCTACGTGCGATTTGCTGTACTGTTCTTGCTGTATGCCGTGTCAGAGTCAGGCACAATCTTGGTCTTCAGGTCGGGTCAAAATGACAGAATGAACTGAACCTCAATAATGA
CATTTCTGACTTTTTTTCTGTATGGAGTTGCTTTCTTGCTTTCTTATTAAACATTTGCGTGTTCAGAAATCATAGAAATGTTGAACATCTTTTAACCTTTTTTTTCAAAGCGTCAAGTCA
CATTCCGATTAAGATATCATTATCCCTGGCAATTTCTCGAACCGTAAGATGACACTGACAACAAGGGAGACAGTAATTAACACAGTAAATTATATTAATTCCTTTACATCACTGTTTCAG

GTGCTCACGCCATAGGCAATTCACACTGCGTCTCCTTCGCCAAGCGGCTCTACAACTTCACCGGCAAGGGCGACGCCGACCCGACGCTCGACCGGGCGTACGCCGCGGCGGTCCTCCGCG
CCGCCTGCCCGCCGCGGTTCGACAACGCGACCACCGTCGAGATGGTGCCGGGGAGCTCGACGACGTTCGACACCGACTACTACAGGCTGGTGGCGAGCCGGAGGGGCCTCTTCCACTCCG
ACCAGGCGTTGCTCCAGGACAGGGAGGCGGCGGCGACGGTGCGCGTCATGGCGAGGTCGAGCAGGCAGGCGTTCTTCCGGCGATTCGGGGTGTCCATGGTGAGGATGGGCAATGTCGGGG
TCCTGACGGGAGCCGCAGGAGAGATCAGGAAGAACTGTGCTCTGATTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAGCTGCTCGCGATGAAGCTGATCCTGACGACGCTCGTCGTCGCCGTGCTGGCGCTGTCCGCCGGCACGGCCACGGCCACCTGCGACACGCTCACGGTCGGGCACTACCGGCAG
TCGTGCCGCGCCGCCGAGACCATCGTGCGCGACACCGTCAAGCTCTACTTCTCAAAGGACCAGACCGTCACCGCGCCGCTGCTCCGCCTCCACTTCCACGACTGCTTCGTCAGG
GGATGT
GACGGATCGGTGTTGCTGAACGCGACGGCGGCGAGCGGGCCGGCGGAGAAGGACGCGATGCCGAACCAGAGCCTGGACGGGTTCTACGTCATCGACGCCGCCAAGGCGGCGCTGGAGAAG
GAGTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTGGCGCTGGCGGCCAGAGACGCTGTCTCCATG
GCTGCCGGGAACATCAATGGCGCGAGCCTTTGGCAAGTCCCGACGGGGCGGCTC
GACGGCCGCGTGTCGTCGGCGGCGGAGGCCGTGGCCAACCTACCGTCTTCTTTCGCGGATTTCGCTAAGCTCAAGGAGCAGTTCGGTTCCAAGGGCCTAAATGTGCAAGACCTCGCGATC
CTATCAG
GTGCTCACGCCATAGGCAATTCACACTGCGTCTCCTTCGCCAAGCGGCTCTACAACTTCACCGGCAAGGGCGACGCCGACCCGACGCTCGACCGGGCGTACGCCGCGGCGGTC
CTCCGCGCCGCCTGCCCGCCGCGGTTCGACAACGCGACCACCGTCGAGATGGTGCCGGGGAGCTCGACGACGTTCGACACCGACTACTACAGGCTGGTGGCGAGCCGGAGGGGCCTCTTC
CACTCCGACCAGGCGTTGCTCCAGGACAGGGAGGCGGCGGCGACGGTGCGCGTCATGGCGAGGTCGAGCAGGCAGGCGTTCTTCCGGCGATTCGGGGTGTCCATGGTGAGGATGGGCAAT
GTCGGGGTCCTGACGGGAGCCGCAGGAGAGATCAGGAAGAACTGTGCTCTGATTAATTGA

Retrieve as FASTA