Entry information : EguAPx09
Entry ID 11165
Creation 2012-06-14 (Qiang Li)
Last sequence changes 2016-04-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-04-07 (Christophe Dunand)
Peroxidase information: EguAPx09
Name EguAPx09
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type Mesophyll cells
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguAPx09
start..stop
S start..stop
EglAPx09 589 0 1..287 1..287
EgrAPx09 588 0 1..287 1..287
LsaAPx02 500 0 1..287 1..285
RcAPx02 499 0 1..287 1..288
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10158..10270 113 N° 2 9921..10045 125 N° 3 8907..8956 50 N° 4 8383..8448 66
N° 5 8258..8306 49 N° 6 7287..7369 83 N° 7 7121..7200 80 N° 8 6929..7031 103
N° 9 6155..6349 195  
complement(join(6155..6349,6929..7031,7121..7200,7287..7369,8258..8306,8383..844 8,8907..8956,9921..10045,10158..10270))


exon

Literature and cross-references EguAPx09
Literature Keller,G., Marchal,T., SanClemente,H., Ladouce,N., Wincker,P., Couloux,A., Teulieres,C. and Marque,C. Development and functional annotation of an 11,303-EST collection from Eucalyptus for studies of cold tolerance Tree Genet. Genomes 5, 317-327 (2009).
EST ref. GenBank:   CU403942.1 [5' end]
Protein sequence: EguAPx09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   287
PWM (Da):   %s   31363.11 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVDTEYLKEIDKARRHLRALIAYKNCAPIMLRLAWHDAGTYDAKTKTGGPTGSIRNEEEYSHGANAGLKIALDFEDVKSKCPRITYADLYLAGVVAVEVTGGPTIDFVPGRKDSRVSPNEGRLPDANQGPPHLRDIFYRMGLSDKDIVSLSGAHTGRAHPERSGFDGPWTQEPLKFDNSYFVELLKGESEGLLKLPTDKALLEDPAFRPYVELYADEDAFFRDYVISHKKLSELGFTPSSSGSKTVANGAVLAQGAVGVAVAAAVVILSYFYEVRKKMK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Scaffold_9_32440 (10270..6155)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTGCCGGTGGTCGACACGGAGTACCTGAAGGAGATCGACAAGGCCCGCCGCCACCTCCGCGCGCTCATCGCCTACAAGAACTGCGCTCCGATCATGCTCCGGCTGGCGTAAATT
TCGCTTCGCCCCCGCCTCGATCGGCGACGACGGTTTTCTTTCTTCGATTCGATTAGCTCGCCGGTTTCTGACGTCCGGAGGTTTTCGCCGATTCGGTCTTTGCAGGTGGCACGACGCCGG
GACCTACGACGCGAAGACGAAGACCGGCGGCCCCACCGGCTCGATCCGGAACGAGGAGGAGTACTCCCACGGCGCCAATGCCGGCTTGAAGATCGCTCTTGATTTTTGCG
GTGAGCTCTC
CGCTCTTTCCGAGCTACCTGTCTTCGGTTCTCCGCCTTNGCTGTTTTCGTTCCTTCGGCGGAGCCGTGTCTTCGCCTGTCCAGCGTCCCGTGCCGAAGTAGTTGCTTGAGTTCANCTATT
CATGCGTTGACAGCAGTTCGGAGGGTGTGCATGCAATTGTAGGTTGCGATTGTGCGATTCCCGTTGCGTGCTTATATGATGCTAAATAGATATAGGTGCTTCGAGATTAGAAAGTCCAAT
TTCCATGGACGTCTGTCTTCTAATACAAGNAGTCTGCTTCAATTATAGCTTTCCTTCACTTGCTGCTGTTGGAGGCCTTCGCGTTTGCTTATGTTTTGTGTTATTTGATGAGTAATGTTT
GACTTGATCAATTATCTTACGATGTTTAGTGCTCGGGGTGCCGGTTGTCTGTTATACTGAAGACAGTTAACGAGTTTGTCAACGTGATGCTATGTACTTACAAATTCTTGAAAGGCCAAG
CAGTGCGTTTGCATACTCTGATTTACTTTTGTTACTTGCTAGGTTCATTTAACCAAGTTTAGATATATTTGCAATATTCATCAGTATAGAATGAATGAAGATAATTATTACTNCAGACAT
TGTTACTTCCTTTAAAGAAATCCCTACAGTTCTCATAAAGTTGAGGTATATGTAATATCCTATGTTCAGTTTATGAGAGCATGCTTAACATGGGTGGTTTAGTGTTCTGTCTAGTGCTTC
CATGATTGTTGACCAAGGAAATCCTAAGACTGTTGCATATATTTTACACAAGTCAACTTGTAGATATACACAAGTCAACTTGTAGATATGTTATGTTTCTAATAGTTTCAACTNTACAAG
TGTAGGAACCCATCANGGATAAGGTCATAGCTTTGATGAATAGACTTTTTTGCAAATGGAGTTGAGATATAACTTCAATCAGTATATTTACATTTGCTTTTATGTTGGATACAGAGGATG
TGAAGTCCAAATGTCCGAGGATTACATATGCAGATCTATACCAG
GTGAAATGACTGTTTAAAGGATTCGTTCTTCTGTCTTANATATCACGAGTTGGCTCCCCCAATAGGTGGACAAAAT
CATTGCTGATATAACAAGCTTAGTTTATAAAAGACTTTGAATTCTTGCCATTTAACTTTGATGTTTTCTGCCCTCCAGCATGCGACATCTTCAAAACTAATATGCATGCGCGTGGTGAAG
CCCTTAATTGGCATAACCCAGAAATTCTTTATTTTGAGATACTTTAGGAACAAATCTTTATTTATCTTATTTTTAGTCCTCTGGGAATTTGGTTCTCAGTTGTTTATAGGAAATCTCCTC
TGTCTAGTTCAACTGGTAACATCCTTGGTTGTTTAGTGGTTGAATAATGTTATATTATAGCTGATCAATTCTAGTGGTTACTATAAATAATGGCTTATCAATTTGCGAGTATTGATCATT
ATGAGCGAATTGCCTGTTTCAGCTAGCAGGAGTTGTTGCAGTAGAAGTCACTGGAGGTCCCACAATTGACTTTGTTCCTGGAAGAAAGGTACTCTGTTTTATCTGTATGTGAGCAAGATA
ATTCTTACGAGTGCCTTATTCATTAAGTTTTTTTCTATCTGCAGGATTCAAGAGTTTCTCCAAATGAAGGAAGACTTCCAGATGCTAATCAAGGTATTCTGTTGTGTCAACTTTCCCTTT
GTTGTTTGGCCTCCCTTCATTTCCCTCCATCCCTCCCTCCAAATATTATGGTCCACTCTGCTTCTTATTGCTCCAGGCAAAAAGTTAAATAACTATTTATTGTTTTCCTTATGGTTGCTG
CCTGTTAATGTTGAAATGTATGTCCATCTCATCTGAATGTCAATTAGTAAATTTACAGAGGAATGATTTGAATGAGATAAGAAGTGCATTGAAACAAGGGTATCNGAGCTAANTGACAGT
CAGATGTTGTCCATCCCATCTAAATGTCAGTAAGTTTCCCGATTAAGAACCTCACATGCAAAATGGGCACAGTGCCTATTTTGTATGAGTCAGCTGTTGTGAACTCACCACAAAGAATGA
GTTGAGAGAGAAGTGCTGGGATTTGAACTCTTGATCTGTCATCTGAAACAGTGCTAGAATATCCAACCTAAAAGTTTAAGCATTGATGTGGAGAGAGGCAACATGTATGTAAGAAAACTT
TAGCCATCAGGTGAGAGAGACTATATGTGTGTGAGACACATTATGACNATGTTTTCAAGGGATGTTTGATTATCCTAAAAGACNATATTACTACTCATGCGAACCCAGTTTGATATTTCA
CATGATATTTTACATCTGCAACTCACTCTAGCTGAGTGAAAGGAGGCTCAAATGAAAGGAGGCCTTCAACNGCAGCTTGGTTAAGCTTTATCAATTTGTGATATTCACGTTTAACAGTCC
ACTGCCTACCTATAACTTATCATAGCTCTAAATCCATCGGAGATTTTTCATGCGTTATAATTCTTTTATTGGGGAAATACATGTACATTTTGCTTGAAGGGTATTCGAAATTTTTTCTAA
ACTTGTCATTGCTGGATGTAGGTCCTCCACATCTAAGGGACATCTTTTACAGGATGGGCCTGTCAGACAAGGACATAGTGTCCTTATCAGGGGCTCATACACTGGTAATTTCTATTTCTG
CTTGGATTTACATTCAAGGTCAGCTGGCCATGTGCAACCACACTTGTTATATTTTCATTCTTGTTTCTAGGGAAGGGCACACCCGGAAAGATCTGGATTTGATGGTCCTTGGACTCAGGA
ACCCCTTAAGTTTGATAATTCCTATTTTGT
GTAAGATTTCGCCTGTTCGCTGGATGCATTTTCTACATTTCAGCTGGAGCATTATAGAGCCAGATACTAATTGATCATTTTTGATACAGC
GAGTTGTTGAAAGGGGAATCAGAGGGGCTGCTGAAACTGCCAACTGACAAGGCATTGCTGGAAGATCCTGCATTTCGCCCTTATGTTGAGTTGTATGCGAAG
GTAAATAGGCTTTTCGCG
TGTTCTGGTGACTCCATTGATAAATCTATAAAATTGAATTGCAGTTACATGGTTTCCTTTTGTAAATTTGTTTTTGATGAAACTACCCCACCTGCACCACTATCTCATTTCCTTATGCAC
ATGGTCTACAACCCTCTGATGCTGCTGTCCTTGGTTTTGCCAAGATTGAAATAAGATGGAAAGTGTTTTTCATGGAATTTATGCTGTATAGGCTTGTGATGCTAAAAAATAAGCATTCAG
TCTGTTCCATCACCATCTTCTATGTAGAGACCAGGAATCTTCATAATGAGATCGCGCATCAAATGTTGGGTAGATATATACATGTGTTGGGATGGATATATTATGTGGATCCCTGAAACC
TCTAGGCTAGAGCATCATCTTTGTGCTACTGGGAACACCTGATTTGATATTTGAATTGGTTGTTGTTCCCGCAACTCTCTCACGGTGGTTGGCATGACCTTGAAGAGAGACAAACGGACA
ATTTGNTACTCTGCTTCTTTTTCCCCTCGTTTTCTTTTGTCATATGCTCTTCTTTCCCTAATGTTGTCAAGCATGTGGCAGGATGAGGATGCATTTTTCAGAGATTATGTAATCTCGCAT
AAGAAGCTCTCTGAACTGGGNTTCACGCCAAGTTCTTCAGGCAGCAAGACAGTAGCGAATGGTGCTGTATTGGCACAAGGTGCTGTCGGAGTGGCAGTGGCTGCAGCCGTGGTGATCTTG
AGCTACTTCTATGAAGTGCGCAAGAAAATGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTGCCGGTGGTCGACACGGAGTACCTGAAGGAGATCGACAAGGCCCGCCGCCACCTCCGCGCGCTCATCGCCTACAAGAACTGCGCTCCGATCATGCTCCGGCTGGCGTGGCAC
GACGCCGGGACCTACGACGCGAAGACGAAGACCGGCGGCCCCACCGGCTCGATCCGGAACGAGGAGGAGTACTCCCACGGCGCCAATGCCGGCTTGAAGATCGCTCTTGATTTTTGCG
AG
GATGTGAAGTCCAAATGTCCGAGGATTACATATGCAGATCTATACCAG
CTAGCAGGAGTTGTTGCAGTAGAAGTCACTGGAGGTCCCACAATTGACTTTGTTCCTGGAAGAAAGGATTCA
AGAGTTTCTCCAAATGAAGGAAGACTTCCAGATGCTAATCAAG
GTCCTCCACATCTAAGGGACATCTTTTACAGGATGGGCCTGTCAGACAAGGACATAGTGTCCTTATCAGGGGCTCAT
ACACTG
GGAAGGGCACACCCGGAAAGATCTGGATTTGATGGTCCTTGGACTCAGGAACCCCTTAAGTTTGATAATTCCTATTTTGTCGAGTTGTTGAAAGGGGAATCAGAGGGGCTGCTG
AAACTGCCAACTGACAAGGCATTGCTGGAAGATCCTGCATTTCGCCCTTATGTTGAGTTGTATGCGAAG
GATGAGGATGCATTTTTCAGAGATTATGTAATCTCGCATAAGAAGCTCTCT
GAACTGGGNTTCACGCCAAGTTCTTCAGGCAGCAAGACAGTAGCGAATGGTGCTGTATTGGCACAAGGTGCTGTCGGAGTGGCAGTGGCTGCAGCCGTGGTGATCTTGAGCTACTTCTAT
GAAGTGCGCAAGAAAATGAAGTGA

Retrieve as FASTA