Entry information : CsubAPx01
Entry ID 11186
Creation 2012-07-04 (Christophe Dunand)
Last sequence changes 2012-07-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-07-04 (Christophe Dunand)
Peroxidase information: CsubAPx01
Name CsubAPx01
Class Ascorbate peroxidase     [Orthogroup: APx003]*
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Coccomyxaceae Coccomyxa
Organism Coccomyxa subellipsoidea    [TaxId: 248742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsubAPx01
start..stop
S start..stop
McalAPx04 242 1e-79 5..299 3..292
CatmAPx01_UTEX2591 242 2e-79 6..300 4..301
MeAPx09 241 3e-79 5..300 3..282
SpraAPx03 240 1e-78 5..298 3..298
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 364406..364587 182 N° 2 364772..364872 101 N° 3 365027..365095 69 N° 4 365228..365280 53
N° 5 365633..365805 173 N° 6 366139..366244 106 N° 7 366675..366905 231  
join(364406..364587,364772..364872,365027..365095,365228..365280,365633..365805, 366139..366244,366675..366905)


exon

Literature and cross-references CsubAPx01
DNA ref. GenBank:   AGSI01000017.1 (364406..366905)
Protein sequence: CsubAPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   304
PWM (Da):   %s   32754.17 Transmb domain:   %s   o271-293i
PI (pH):   %s   9.13
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGAPKVDAAYKDAVNKASLDVRDLINKENCIPMLIRLAFNDALTYDAPTNTSGANGSIRIKKELTHEGNKGLQHAVDLLKPIKEKYPNLTYDFFQLAGMLAVEAAGGPVIPFTPGRKDSWSFPPPGRLPDPDATSHLRAVAERLGLPLRQFVALMGAHKLGRWWRDVQPPYFHQFYAPGPLKFDNVYFKDLVSGKLPKDGYLLGDVEFRQIIETYAEDEAIFTDYVVAHEALSLLGTKLPPAREVAAAAAAAAASADGQSLQLPAGAQAAIGVAAVVIGAVVIGGWYWRRRRRLQGSAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGGGGCGCCCAAGGTGGATGCAGCCTACAAGGATGCCGTTAACAAGGCTTCTCTCGACGTGAGAGACCTTATAAATAAAGAGAATTGCATTCCCATGCTGATCAGGCTGGCC
TTCAACGACGCACTTACTTATGACGCTCCAACTAACACATCGGGAGCAAACGGCAGCATCAG
GTCCAGATTCGGCTATAAAATCTGAGTAATATGCATCAACAATTATATTCAACTCAAA
ATGATGTGCTTGAGGGCAATTTGCAGTGTAAGTACATTTTGATGCTTGCAACCTCGGAAGAAGCGCAGGAGCATACGCATGAGCCCCCTGTCCTGGAACAAGCTAGACCCTGTGATATTG
TTACAGAATCAAGAAGGAGCTGACGCATGAAGGAAACAAGGGGCTGCAGCATGCAGTGGACCTGCTGAAGCCCATCAAGGAGAAATACCCCAACCTCACCTATGCAGGTATTTCTCGTTC
ACAATCTGTCAATATGTTTGCAAAATTTCATTTGCTGACTTGGAAACCGAGGAATCAACTGGACTTGGAAAGTGAGAGCTCAAGTCCTGGGCTAGCCTATGAAGTGTTTGCTTCTATCAG
ACAATTCCGATGCTGCTGCAGATTTCTTTCAGCTGGCGGGTATGCTGGCCGTGGAGGCTGCTGGAGGCCCAGTGATCCCCTTCACTCCAGGTTAGTCTGTGTTGCCAGCCAGATTGTTGC
CCCTATGATCGCATGAACGGAATGCTCCCAGGGGGTGCTGAGAAAGACCCAATGACTCTGCTCATGAAGTATATTGCTTGATGTTTTGCCCTGGACTGACAGGGCGCAAGGACTCCTGGT
CATTCCCGCCTCCCGGCAGATTGCCCGACCCCACA
GTTGGTGAGTCACCCCAAGCATGCCCAGACTGCTCCTCTGCAACCACACTTTTTTTCCCACACCTCCAGAAACAGGTTTCTACAC
AATACACTGCTAACATGGCCTGCTGTGCCGGGCCTAGCACATCCCTGTGCACTTGCCACACCCAAACCTTCGCCTATCGTTCCATCTTGGACCAGTGTGCATGCAGCAGCTAGCTTACAC
TTGCTTGTGATTGCCTCCCCTGACCGTTCTGGCATTCCCCTACCTTTGTGCAGAGCTCCGCAAGCCCCGGATCCATCCTGCTTATCATGTCAAACATTTCGCTGTGGCTCTGGATTGAGC
GCCTGTTCTGGCATGCGCGCAGCAGAGGACGCCACGTCGCACCTGCGCGCGGTGGCGGAGCGGCTGGGGCTGCCCCTGCGTCAGTTTGTGGCGCTGATGGGCGCTCACAAGCTCGGCCGC
TGGTGGCGCGACGTGCAGCCGCCCTACTTCCACCAGTTCTACGCCCCCGGGCCCCTCAAGTTTGACAATGTCTACTTCAA
GTGCGCTGCCCCAAAGTATACACATCCATTTTCTGGAGCT
GTGGATGCAATGCAGTTACTAGTGCAATGTAAGCTTGTCTGCAGATCCAAAGTGGGATCTTGCAGTATATGCAAAGCTGCCTCCCTGTCGCAGCACAGACACGACACCCATGCACGAGGT
AATTCAGGCGGAGTGGTGATAACACCTAATGTTGAGGTGGCACAAGATAGCGGTTCTGCAAGTGTGCCTTCACAGCCCTTGCAGTGGCGACAAGCAAGGAGGGCTGTGAGTAGGCACACC
TGCTTTTTCATGATGCTTACATGTTGTGAACTGGTGCGGCTTGCTGCGCGCAGGGATTTGGTGAGCGGGAAGCTGCCCAAGGACGGCTACCTGCTGGGCGATGTGGAGTTCCGCCAGATC
ATTGAGACCTATGCAGAGGACGAGGCCATCTTCACCGCG
GTGCGATCTTTGCCCGCCTCTTTCTCATAGATAGGCAATCTGCAAAATAGGTGTTTCGGCAGTATATAGACACAGCAGTTC
TCGTGAGTTCATTGCAAGGTTCCTGCTCGGTGCAAGATTCCTGCTCAGCTGATCTCTTGTGGCAACACAGCAGTTTTCATGAGCTCAGTGCAAGGCTCCTGCTCGGCTGATCGCTTGTGG
GAACACAGTGGTTTTTGTGCGGCGAGTGCATGATCTCCTGCCTTGAGGAGCTGGTCCTGTGGCTCTCCAGAACCACATGTCGCATTCAACATGAGCGAGTGGGGCTCAATTCTGTTGTAG
TCTTCTGAGTAGATCATGTTGCAAAATAGGGGCTGAGGGCAATGGGAGCGCAGTATTTAGGTTGAGGCACATCTTGCACAGTGCACCTTAGAGACTTAATGGATTGCAGGACTATGTTGT
GGCGCACGAGGCGCTGTCGCTACTCGGCACGAAGCTGCCGCCCGCGCGCGAGGTGGCCGCTGCGGCGGCGGCGGCGGCCGCTTCGGCAGACGGGCAGTCGCTGCAGCTGCCGGCGGGCGC
GCAGGCGGCCATCGGCGTGGCGGCCGTAGTCATCGGGGCGGTAGTTATTGGCGGCTGGTACTGGCGGCGGCGCCGGCGGCTGCAGGGGTCGGCCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGGGGCGCCCAAGGTGGATGCAGCCTACAAGGATGCCGTTAACAAGGCTTCTCTCGACGTGAGAGACCTTATAAATAAAGAGAATTGCATTCCCATGCTGATCAGGCTGGCC
TTCAACGACGCACTTACTTATGACGCTCCAACTAACACATCGGGAGCAAACGGCAGCATCAG
AATCAAGAAGGAGCTGACGCATGAAGGAAACAAGGGGCTGCAGCATGCAGTGGACCTG
CTGAAGCCCATCAAGGAGAAATACCCCAACCTCACCTATGCAG
ATTTCTTTCAGCTGGCGGGTATGCTGGCCGTGGAGGCTGCTGGAGGCCCAGTGATCCCCTTCACTCCAGGGCGCAAG
GACTCCTGGTCATTCCCGCCTCCCGGCAGATTGCCCGACCCCACA
GACGCCACGTCGCACCTGCGCGCGGTGGCGGAGCGGCTGGGGCTGCCCCTGCGTCAGTTTGTGGCGCTGATGGGC
GCTCACAAGCTCGGCCGCTGGTGGCGCGACGTGCAGCCGCCCTACTTCCACCAGTTCTACGCCCCCGGGCCCCTCAAGTTTGACAATGTCTACTTCAA
GGATTTGGTGAGCGGGAAGCTG
CCCAAGGACGGCTACCTGCTGGGCGATGTGGAGTTCCGCCAGATCATTGAGACCTATGCAGAGGACGAGGCCATCTTCACCGCG
GACTATGTTGTGGCGCACGAGGCGCTGTCGCTACTC
GGCACGAAGCTGCCGCCCGCGCGCGAGGTGGCCGCTGCGGCGGCGGCGGCGGCCGCTTCGGCAGACGGGCAGTCGCTGCAGCTGCCGGCGGGCGCGCAGGCGGCCATCGGCGTGGCGGCC
GTAGTCATCGGGGCGGTAGTTATTGGCGGCTGGTACTGGCGGCGGCGCCGGCGGCTGCAGGGGTCGGCCGCCTGA

Retrieve as FASTA