Entry information : EguPrx95
Entry ID 11188
Creation 2012-07-10 (Qiang Li)
Last sequence changes 2012-12-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-22 (Christophe Dunand)
Peroxidase information: EguPrx95
Name EguPrx95
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx95
start..stop
S start..stop
EglPrx95 654 0 1..318 1..318
EgrPrx95 654 0 1..318 1..318
EcamPrx95 647 0 1..318 1..318
MePrx114 516 0 17..317 19..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26279..26485 207 N° 2 26699..26887 189 N° 3 27036..27198 163 N° 4 27397..27794 398
join(26279..26485,26699..26887,27036..27198,27397..27794)


exon

Literature and cross-references EguPrx95
Literature Identification of 8050 cDNAs from a normalized Eucalyptus xylem full-length RT cDNA library, Sivadon,P., Ladouce,N., Wincker,P., Couloux,A., San Clemente,H. and Grima-Pettenati,J. Unpublished (2006).
EST ref. GenBank:   CT984860.1
Protein sequence: EguPrx95
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (296)
PWM (Da):   %s   34047.34 (31933.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.56 (8.40) Peptide Signal:   %s   cut: 23 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRALAVVLGSAILLAYVASSAGALSLDYYDQTCPKLEYSVRGAVKKAMKNDNTVPAALLRMHFHDCFIRGCDGSVLLNSTAKNTAEKDGPPNISLHAFYVIDLAKEAVEAQCPGVVSCADILALAARDAVALSGGPHWDVPKGRKDGRISKANDTSQLPAPTFNISQLQQSFSQRGLSMEDLVALSGGHTLGFAHCSSFQNRIHNFTSVDDIDPSLHPSFAAQLRKVCPAHNTVRSAGSTLDPTVTKFDNVYYKMLLQGKSIFTSDQALLTVPKTKALVSKFAGSQEEFEKAFVKSMIKMSSLSGGGQEIRLNCRVVR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 1 EST. Scaffold_6_22113
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCCCTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACATGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GTAACTACTTGTTAATCCTTCACTCTCTGGTAA
ATTTTTCCATGTGAGGTAGGGCTAGCTGTGTATGTTTTCGGCCTTTGTTAGTTCTCCTACGAAGACAAATGAAAAATGACTGCTTCTAGGGAACAACTCGTCTCGACGAGACAAGAGTAA
TTCAAGTTTGAACTTTTAAGGCATTCATTAATGGTANTAAAGCTTTGATATTATTTCCAGGGATGTGACGGTTCCGTGCTCCTGAACTCGACGGCAAAGAACACAGCCGAAAAAGACGGG
CCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGACATCTTGGCCTTGGCTGCTCGGGATGCT
GTCGCTCTG
GTGCTTTATGTTTTCCATATCCACTATAACTTACATTCACCTGCGTGTCATTGACATGTCCCGCAACATACGTGGTCAAAAGTTAACTCGCGCTACCTTGCGATTATTTCT
AATAATTCAGCATGGTTTTTCCTGATCTCCGTTGTAGTCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGTCAATTACCAGC
TCCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCTG
GTACGAATATTTACAAATTTTCATATGTATACACATGAGC
ACTCCGCATTCATCACGCGTATGTGCATACGTACGCTGCGGCTTACATAAACTCATGCATTCTTAGAAGTGGTCGAAACATATAAGCCAGTATTCAACGGAAACGCCATCGCATGCCCTT
TCGGGGATTAAGTACTGATATATGCGCCTCTGTTACAGGTGGCCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAGAACCGGATCCACAACTTCACCTCTGTGGACGATATCGACCC
GTCGTTGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCCGCGCACAACACGGTGAGGAGCGCGGGGTCCACGTTGGATCCCACGGTGACCAAGTTCGACAACGTGTACTACAA
GATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACGAAAGCACTGGTCTCCAAGTTCGCCGGGAGCCAGGAGGAGTTCGAGAAGGCCTTCGT
GAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCCCTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACATGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GGATGTGACGGTTCCGTGCTCCTGAACTCGACG
GCAAAGAACACAGCCGAAAAAGACGGGCCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGAC
ATCTTGGCCTTGGCTGCTCGGGATGCTGTCGCTCTG
TCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGTCAATTACCAGCT
CCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCTG
GTGGCCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAG
AACCGGATCCACAACTTCACCTCTGTGGACGATATCGACCCGTCGTTGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCCGCGCACAACACGGTGAGGAGCGCGGGGTCCACG
TTGGATCCCACGGTGACCAAGTTCGACAACGTGTACTACAAGATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACGAAAGCACTGGTCTCC
AAGTTCGCCGGGAGCCAGGAGGAGTTCGAGAAGGCCTTCGTGAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGTTAA

Retrieve as FASTA