Entry information : EguPrx75
Entry ID 11189
Creation 2012-07-10 (Qiang Li)
Last sequence changes 2016-03-12 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-13 (Achraf Jemmat)
Peroxidase information: EguPrx75
Name EguPrx75
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx75
start..stop
S start..stop
EgrPrx75 685 0 1..333 1..333
EglPrx75 682 0 1..333 1..333
EcamPrx75 676 0 3..333 1..331
PtPrx02 637 0 1..333 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11888..12124 237 N° 2 11350..11538 189 N° 3 10839..11004 166 N° 4 10276..10685 410
complement(join(10276..10685,10839..11004,11350..11538,11888..12124))


exon

Literature and cross-references EguPrx75
Literature Identification of 8050 cDNAs from a normalized Eucalyptus xylem full-length RT cDNA library, Sivadon,P., Ladouce,N., Wincker,P., Couloux,A., San Clemente,H. and Grima-Pettenati,J. Unpublished (2006).
EST ref. GenBank:   CU397450.1   CU404812.1
Protein sequence: EguPrx75
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (309)
PWM (Da):   %s   37329.27 (34912.9)  
PI (pH):   %s   8.21 (8.02) Peptide Signal:   %s   cut: 25 range:25-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASKALIFLALLSFSAVSLTPAIAEINEEDKPGLVMNFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADILVLSARDGIVALGGPHFPLKTGRRDGRKSRADVVEQYLPDHNESISVVLDRFAAMGINTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPVLNPDHIEHMLHKCPDAIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLIVDHQLATDKRTKPYVKKMAKSQDYFFKEFARAITILSENNPLTGDQGEIRKQCNVANKHH

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs. scaffold_4_13378 (12124..10276)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCNGTGTCACTGACACCTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAG
GACACCTGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAACACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTCAG
GTA
TCAAACCTGCGTTGTGCTTAACGTCAGTTCCGCTCGATTGTTTTCAAGTTTAACGAGCAACATTTGTGTTTTTCTTGNAAAAGAAACAGCTTTTNCGCTATNTTTCACTCNTTTTCCAGN
ANTTTTTTGNNCTCGGGTTTGACCAATGAGCTTTATCTGGAGTCAAGAACCCAGATCTCCCTAGTGAGGCTTGGTCGAGCTAGCAAAATGAGAAATTATCAAACTCGATCTCTTAAGTTT
TGGAATTGAGATTTAAGTTCAAGAAGTATACTATGTTGACTCAACTCAGCTCGTTTTTTGCGTTAGTGTTCGGAAACGTCATTTGCCTTGTGTGATGTGAATGCAGTCATGTGATGCTTC
CCTGCTCTTGGATTCGACGCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGGGAATGCCCTGG
AGTTGTTTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
GTACTCACTCTTGTTGTTGTCCTAATTATGATGTTTGAGTATGAATATATAGAATCTGTAGATCT
TTGCTTCCTGTGTTTCTCTTTAATCTCTCTGTCGTATATGCTCTGTATATTTAATAACCCTTTCCTTTTGTTTTGAGTGAACAAAATATCTATCTGTACACTAGTCCTTTTGGCTAGTGT
TTGNGAAATCTGATAAGTTCACATATTTCCCCTGGGGATGAAGGTACCTCAACTCTGCCATATTTTACCCTTCTTTCTCAGTAACTTGTCAGCTTGTTCTTATATGGACTTTCAAGAAAA
TTGGTGAAATCTGGTCTTGAAATTCACTCTCTCTGAGCAGCTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGCCGAGCTGATGTGGTCGAACAATACCT
TCCAGATCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAATACACCAGGAGTGGTTGCTTTACTAG
GTAATTTACTNTANGATCCTAGTGCTTCACCATC
AGCTTTATTTTCCTAAAGTTGTTTAGCCTGCATATTGTAAAATCAGTATGCATGTTTGGTNATAATAATCTTAGTTGCTTGGTTGGTGCATCATTCTGTCTCCTGAATTTGTCTAACAGG
AGCTCACAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGTGCTGAACCCAGACCACATTGAGCACATGCTTCACAAGTGCCCGGATGCGAT
CCCAGACCCAAAGGCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAACAAGGGCTTGTTAATCGTGGACCACCAGCT
TGCCACTGACAAGCGGACCAAGCCCTATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACNATCCTCTCTGAGAACAACCCTCTCACTGGTGA
CCAAGGTGAGATCAGGAAGCAGTGCAATGTTGCCAACAAGCACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCNGTGTCACTGACACCTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAG
GACACCTGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAACACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTCAG
TCA
TGTGATGCTTCCCTGCTCTTGGATTCGACGCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGG
GAATGCCCTGGAGTTGTTTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
CTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGC
CGAGCTGATGTGGTCGAACAATACCTTCCAGATCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAATACACCAGGAGTGGTTGCTTTACTAG
GAGCTCAC
AGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGTGCTGAACCCAGACCACATTGAGCACATGCTTCACAAGTGCCCGGATGCGATCCCAGAC
CCAAAGGCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAACAAGGGCTTGTTAATCGTGGACCACCAGCTTGCCACT
GACAAGCGGACCAAGCCCTATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACNATCCTCTCTGAGAACAACCCTCTCACTGGTGACCAAGGT
GAGATCAGGAAGCAGTGCAATGTTGCCAACAAGCACCACTAG

Retrieve as FASTA