Entry information : EguPrx72
Entry ID 11191
Creation 2012-07-10 (Qiang Li)
Last sequence changes 2012-12-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EguPrx72
Name EguPrx72
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx72
start..stop
S start..stop
EgrPrx72 666 0 1..327 1..327
EglPrx72 666 0 1..327 1..327
EcamPrx72 663 0 1..327 1..327
EgrPrx71 598 0 1..327 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29177..29401 225 N° 2 29754..29939 186 N° 3 30170..30335 166 N° 4 30519..30925 407
join(29177..29401,29754..29939,30170..30335,30519..30925)


exon

Literature and cross-references EguPrx72
Literature Development and functional annotation of an 11,303-EST collection from Eucalyptus for studies of cold tolerance. Keller,G., Marchal,T., SanClemente,H., Ladouce,N., Wincker,P., Couloux,A., Teulieres,C. and Marque,C. Tree Genet. Genomes 5, 317-327 (2009).

EST ref. GenBank:   CU400119.1 [5' end]
Protein sequence: EguPrx72
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35706.47 (32665.9)  
PI (pH):   %s   8.54 (8.86) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACPKLFLSCLLLELMFFFLVPEVAQGHSLKVGFYGKACPNAEAIVKEAIGQILSVAPSLSGPLLRLHFHDCFVRGCEGSVLLDSPTYQSEKYAFRKHGLRGYQEIDRVKTALEKACPGIVSCADILALVARDIVVATGGLFYDVETGRRDGYVSISEEARRDLIPPTTNITTLKADFAKRGLSAKDLVILSGGHTIGNSHCSPFSNRLYNFTGKGDADPTLDSNYIARLKLSCKPNDQTTLVEMDPGSARTFDIKYFDLILKRRGLFTSDAALLDDNQTKAYLDFQIKTGGSTFFKDFGVSMVKMGRIGVLPKMAGEVRKVCTKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 1 EST. Scaffold_3_9977 (29177..30925).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTCTCAAAGTAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGCCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GTAAGTAAGAGAGCA
AGCTCCCATACTACTCGTCGTACTACGCGTTTGAAGTTTANCATTTTCTTATAACTTGACTAGTTGCTATAACTAATGTTCGGATAAACAGAGGGTGAGAAGTTAGACCCTGGGCTTTCA
TCTGAAGGGGTAATGCATGGCAGGGATGCGTCGAGATTTACTAAATAGGTTTACCTGATAACAATATGATAAAATGGAAAATGTGTCTTAGAACTAGTAATATACCAGTAAATGGTATTT
GGCTCTCAACATACTTCTCTAGATTCGTCTTTGGTTATGAGCTATTGTTTTCATGAACTCACGGTTGAATGATGCTTTGTTCTGGGTTTTTGCACAGGGCTGTGAAGGTTCGGTACTACT
GGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATCGTTTCGTG
TGCTGACATCTTGGCCCTTGTCGCCAGAGACATTGTCGTCGCG
GTGCGCCTATTCATAAATCATCTCAATATTTTATTATCAATTTGATTGTTTGTCACACCAGTACTACGTTAGTAGAA
TTCTCAATTTTTATCACACAGTCTACGTTATCACATTGGAAAACAAATTTGAGCCACACGTATCATAAAGGATAGGTACCGATAATTTTTTTAATGAGAAAAACATTTTTATATAGAAAT
TGGGGGTTTTCTTTTTTTGTGCTATCGCTTTAGACTGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCACGTAGGGATTTAATACCA
CCGACGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGTCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTAACACCTAATCTCCAATTACTGTTTTACATGCTTGTCAA
ATATATTGGATATATTGANATAAATTCATCTNGTAAAAAATTGTCATTTGAGCGTGAGATACATNAACGCAATCAGTGGTCCAGGGAGAAAATGTAATTTGTAAGGTAAGATCAATGTCG
ATTCTACTTTCCAATTGACCAGGTGGGCACACCATTGGAAATTCACACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAAC
TATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGA
GGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACCAAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAA
ATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGAAAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTGAGTTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACAGTCTCAAAGTAGGGTTTTACGGGAAGGCATGCCCA
AACGCAGAGGCCATCGTGAAGGAAGCCATTGGCCAAATCTTGTCCGTCGCTCCGAGTCTTTCTGGCCCTCTTTTGAGATTGCATTTTCACGATTGCTTCGTTAGG
GGCTGTGAAGGTTCG
GTACTACTGGACTCTCCGACCTATCAATCCGAGAAGTACGCCTTTCGAAAGCACGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATC
GTTTCGTGTGCTGACATCTTGGCCCTTGTCGCCAGAGACATTGTCGTCGCG
ACTGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTATGTTTCTATTTCGGAGGAGGCA
CGTAGGGATTTAATACCACCGACGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGTCTCAGTGCGAAGGACCTCGTTATCCTATCAG
GTGGGCACACCATTGGAAATTCA
CACTGCTCTCCCTTCTCCAACCGCCTCTATAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAACTATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACC
ACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCTTGAAAAGAAGAGGGCTCTTCACTTCGGACGCTGCACTTCTAGACGACAACCAAACC
AAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCAATGGTGAAAATGGGTCGAATTGGCGTGCTCCCCAAAATGGCTGGTGAAGTCAGA
AAAGTGTGTACAAAGGTCAATTAA

Retrieve as FASTA