Entry information : Pno1CysPrx02
Entry ID 11200
Creation 2012-07-16 (Christophe Dunand)
Last sequence changes 2012-07-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: Pno1CysPrx02
Name Pno1CysPrx02
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Pno1CysPrx02
start..stop
S start..stop
Gz1CysPrx 395 5e-142 7..223 6..222
Mgr1CysPrx 378 2e-135 4..222 6..224
Nc1CysPrx 372 6e-133 2..222 4..224
Dh1CysPrx 362 5e-129 8..219 9..220
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1765641..1765984 344 N° 2 1765246..1765588 343  
complement(join(1765246..1765588,1765641..1765984))


exon

Literature and cross-references Pno1CysPrx02
DNA ref. JGI genome:   scaffold_1 (1765984..1765246)
Cluster/Prediction ref. JGI gene:   625
Protein sequence: Pno1CysPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   229
PWM (Da):   %s   25349.24  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSDRSEPLRLGSTAPNFKAETTQGPIDFHEFIGDKWVVLFSHPEDYTPVCTTELGAFAKLEPEFTKRGAKLIGLSANTVESHGGWIKDIDEISGSSLKFPIIGDKERKVALAYDMIDHQDATNVDSKGIAFTIRSVFIIDPKKTIRLILSYPASTGRNTAEVLRVLDSLQTGDKHRITTPINWVPGDDVIVHPSVKNDEAKTLFPDFRIVKPYLRFTPLPKEKTSANV

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGACCGCTCCGAACCTCTCCGTCTTGGAAGCACGGCTCCCAACTTCAAGGCCGAGACCACCCAGGGCCCAATCGACTTCCACGAGTTCATTGGCGACAAATGGGTTGTTCTCTTC
TCGCATCCTGAGGATTACACCCCTGTCTGCACCACTGAGCTCGGTGCTTTTGCGAAGCTCGAGCCCGAGTTCACCAAGCGCGGCGCAAAGCTCATCGGCCTCTCTGCCAACACGGTAGAG
AGCCATGGCGGCTGGATCAAGGACATCGATGAGATCTCGGGTAGCAGCCTGAAATTCCCCATCATCGGAGACAAGGAGAGGAAGGTTGCGTTGGCGTACGACAT
GTGAGTTGCGACACTG
CGCGTCTGTCCGAGACAAGTCTGACCCAGCACCCAGGATTGACCACCAGGATGCCACCAATGTCGATTCCAAGGGCATTGCTTTTACCATCCGTTCCGTCTTCATCATCGACCCCAAGAA
GACGATTCGCTTGATCCTGTCCTATCCCGCCTCGACCGGCCGCAACACCGCCGAAGTTCTCCGCGTGCTCGACTCTCTGCAGACTGGCGACAAGCACCGCATCACCACCCCAATCAACTG
GGTTCCCGGTGACGACGTCATTGTCCACCCCTCGGTCAAGAACGACGAGGCGAAGACTCTGTTCCCAGACTTCCGCATCGTTAAGCCCTACCTGAGGTTCACTCCTCTTCCCAAGGAGAA
GACCAGCGCCAACGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGACCGCTCCGAACCTCTCCGTCTTGGAAGCACGGCTCCCAACTTCAAGGCCGAGACCACCCAGGGCCCAATCGACTTCCACGAGTTCATTGGCGACAAATGGGTTGTTCTCTTC
TCGCATCCTGAGGATTACACCCCTGTCTGCACCACTGAGCTCGGTGCTTTTGCGAAGCTCGAGCCCGAGTTCACCAAGCGCGGCGCAAAGCTCATCGGCCTCTCTGCCAACACGGTAGAG
AGCCATGGCGGCTGGATCAAGGACATCGATGAGATCTCGGGTAGCAGCCTGAAATTCCCCATCATCGGAGACAAGGAGAGGAAGGTTGCGTTGGCGTACGACAT
GATTGACCACCAGGAT
GCCACCAATGTCGATTCCAAGGGCATTGCTTTTACCATCCGTTCCGTCTTCATCATCGACCCCAAGAAGACGATTCGCTTGATCCTGTCCTATCCCGCCTCGACCGGCCGCAACACCGCC
GAAGTTCTCCGCGTGCTCGACTCTCTGCAGACTGGCGACAAGCACCGCATCACCACCCCAATCAACTGGGTTCCCGGTGACGACGTCATTGTCCACCCCTCGGTCAAGAACGACGAGGCG
AAGACTCTGTTCCCAGACTTCCGCATCGTTAAGCCCTACCTGAGGTTCACTCCTCTTCCCAAGGAGAAGACCAGCGCCAACGTTTAA

Retrieve as FASTA