Entry information : GbPrx10 (gba_locus_10862_iso_2_len_1106_ver_2)
Entry ID 11201
Creation 2014-12-02 (Christophe Dunand)
Last sequence changes 2014-12-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2018-01-26 (Christophe Dunand)
Peroxidase information: GbPrx10 (gba_locus_10862_iso_2_len_1106_ver_2)
Name (synonym) GbPrx10 (gba_locus_10862_iso_2_len_1106_ver_2)
Class Class III peroxidase    [Orthogroup: Prx233]
Taxonomy Eukaryota Viridiplantae Streptophyta Ginkgoopsida Ginkgoaceae Ginkgo
Organism Ginkgo biloba    [TaxId: 3311 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Inducer Lignification
Repressor N/D
Best BLASTp hits
Perox score E-value GbPrx10
start..stop
S start..stop
GbPrx46 494 5e-178 19..327 21..329
GbPrx52 433 8e-154 1..327 1..327
PabPrx50 429 5e-152 9..327 12..328
PtaPrx14 427 2e-151 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..213 213 N° 2 303..494 192 N° 3 650..815 166 N° 4 911..1323 413
join(1..213,303..494,650..815,911..1323)


exon

Literature and cross-references GbPrx10 (gba_locus_10862_iso_2_len_1106_ver_2)
Literature Novo-Uzal,E. and Gutierrez,J. olecular cloning of two novel peroxidases and their response to salt stress and salicylic acid in the living fossil Ginkgo biloba. Ann. Bot. 114 (5), 923-936 (2014).
mRNA ref. GenBank:   KC164349.1
Protein sequence: GbPrx10 (gba_locus_10862_iso_2_len_1106_ver_2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (303)
PWM (Da):   %s   35238.62 (32546.2)  
PI (pH):   %s   8.2 (8.14) Peptide Signal:   %s   cut: 25 range:25-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTFAACFLTFLISFLCVKKTNAQLTPLYYQTSCPTAEAIIRPVVQQAVQRDPRMAASLLRLHFHDCFVNGCDGSVLLDDTSTFTGEKSAGPNLNSLRGFEVIDNIKAAVEKSCNSVVSCADILAIAARDAVVLAGGPSWTPMLGRRDSRTASASTANTVMPAPNDTLGIIISKFRAVGLSVQDCVTLSGAHTIGRARCSSFSARLYNFGNTGNPDPAINPFYLNTLRGICPRGGNANAVTSLDQRTPDRFDNSYFTNLRINEGLLQSDQELFSTTGASTTALVNLYSNNQIVFFQNFQNSMINMGNIKPLTGNNGEIRTNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from DNA (3 introns) and RNA seq.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTAACCTTTGCAGCTTGCTTTCTTACATTTCTCATATCCTTTTTATGTGTAAAGAAGACGAATGCTCAGCTAACTCCCCTTTACTACCAGACTTCTTGCCCAACCGCTGAAGCC
ATCATTCGACCAGTTGTTCAACAAGCTGTACAGAGAGACCCTCGAATGGCAGCCTCTCTTCTACGATTGCACTTTCATGATTGCTTCGTTAAT
GTATGTATATTTTTTTAGTCATTCAAT
GTGTAAATCATTCAACTTAGCGTCTGCATTGCATTGAAGTAGAGTGTTTATGGTGAGTGCAGGGATGTGATGGATCAGTGTTGTTGGACGACACATCTACATTTACAGGAGAAAAATCAG
CTGGTCCAAACTTAAATTCACTCAGAGGATTTGAGGTCATTGATAACATCAAAGCAGCAGTAGAGAAGTCGTGTAATAGCGTAGTCTCTTGCGCAGACATTCTTGCTATTGCTGCGAGGG
ACGCAGTTGTTCTC
GTTCGTATAATAAGCATTTGTTCATTTCATTTCTGTTAACGGCTTTGATGTCTATTTATTTCAAATATAGAAAGATTGAGAGAGATTTAAGCTTAATAGTTTGGGA
GTAATGACGTGTGAAACGCTTAATATTAATACTGTTATAATTTATGTAGGCTGGAGGCCCGTCCTGGACTCCGATGTTAGGCAGAAGGGACAGCAGGACGGCAAGTGCAAGCACGGCAAA
CACAGTCATGCCAGCTCCAAACGACACTCTGGGTATCATAATTTCCAAATTTCGAGCAGTGGGACTTTCCGTTCAAGATTGCGTTACATTATCAG
GTATACGAAAAAAAAATCAGCACAC
AATCCGAATTAGTATATATTGAGATATTGGGTCCAATGAATGCTTAATTTATTTCATTCAAAATGTGCAGGTGCTCATACAATTGGGCGCGCTCGCTGCAGCTCCTTCAGTGCTCGCCTA
TATAACTTTGGCAACACGGGTAATCCAGACCCTGCCATCAACCCTTTCTATCTTAACACTTTACGGGGAATTTGCCCTCGGGGAGGTAACGCCAACGCTGTAACTTCACTTGATCAACGC
ACACCCGATCGCTTCGACAACAGCTATTTCACAAATTTGCGGATTAACGAAGGGCTCTTACAGTCGGATCAGGAACTCTTTTCGACCACTGGAGCATCTACAACAGCTCTCGTGAATCTC
TACAGTAATAACCAGATTGTTTTCTTTCAAAACTTCCAGAATTCCATGATAAACATGGGAAACATCAAGCCTCTCACGGGGAATAATGGAGAAATACGCACCAACTGCAGGAAAGTGAAC
TAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTAACCTTTGCAGCTTGCTTTCTTACATTTCTCATATCCTTTTTATGTGTAAAGAAGACGAATGCTCAGCTAACTCCCCTTTACTACCAGACTTCTTGCCCAACCGCTGAAGCC
ATCATTCGACCAGTTGTTCAACAAGCTGTACAGAGAGACCCTCGAATGGCAGCCTCTCTTCTACGATTGCACTTTCATGATTGCTTCGTTAAT
GGATGTGATGGATCAGTGTTGTTGGAC
GACACATCTACATTTACAGGAGAAAAATCAGCTGGTCCAAACTTAAATTCACTCAGAGGATTTGAGGTCATTGATAACATCAAAGCAGCAGTAGAGAAGTCGTGTAATAGCGTAGTCTCT
TGCGCAGACATTCTTGCTATTGCTGCGAGGGACGCAGTTGTTCTC
GCTGGAGGCCCGTCCTGGACTCCGATGTTAGGCAGAAGGGACAGCAGGACGGCAAGTGCAAGCACGGCAAACACA
GTCATGCCAGCTCCAAACGACACTCTGGGTATCATAATTTCCAAATTTCGAGCAGTGGGACTTTCCGTTCAAGATTGCGTTACATTATCAG
GTGCTCATACAATTGGGCGCGCTCGCTGC
AGCTCCTTCAGTGCTCGCCTATATAACTTTGGCAACACGGGTAATCCAGACCCTGCCATCAACCCTTTCTATCTTAACACTTTACGGGGAATTTGCCCTCGGGGAGGTAACGCCAACGCT
GTAACTTCACTTGATCAACGCACACCCGATCGCTTCGACAACAGCTATTTCACAAATTTGCGGATTAACGAAGGGCTCTTACAGTCGGATCAGGAACTCTTTTCGACCACTGGAGCATCT
ACAACAGCTCTCGTGAATCTCTACAGTAATAACCAGATTGTTTTCTTTCAAAACTTCCAGAATTCCATGATAAACATGGGAAACATCAAGCCTCTCACGGGGAATAATGGAGAAATACGC
ACCAACTGCAGGAAAGTGAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACGCGGGGGA TCACAGATTG AGATTCATAT GTGGAGTAAT GGAGTTAACC TTTGCAGCTT GCTTTCTTAC ATTTCTCATA TCCTTTTTAT GTGTAAAGAA GACGAATGCT CAGCTAACTC  CCCTTTACTA CCAGACTTCT TGCCCAACCG CTGAAGCCAT CATTCGACCA GTTGTTCAAC AAGCTGTACA GAGAGACCCT CGAATGGCAG CCTCTCTTCT ACGATTGCAC TTTCATGATT  GCTTCGTTAA TGGATGTGAT GGATCAGTGT TGTTGGACGA CACATCTACA TTTACAGGAG AAAAATCAGC TGGTCCAAAC TTAAATTCAC TCAGAGGATT TGAGGTCATT GATAACATCA  AAGCAGCAGT AGAGAAGTCG TGTAATAGCG TAGTCTCTTG CGCAGACATT CTTGCTATTG CTGCGAGGGA CGCAGTTGTT CTCGCTGGAG GCCCGTCCTG GACTCCGATG TTAGGCAGAA  GGGACAGCAG GACGGCAAGT GCAAGCACGG CAAACACAGT CATGCCAGCT CCAAACGACA CTCTGGGTAT CATAATTTCC AAATTTCGAG CAGTGGGACT TTCCGTTCAA GATTGCGTTA  CATTATCAGG TGCTCATACA ATTGGGCGCG CTCGCTGCAG CTCCTTCAGT GCTCGCCTAT ATAACTTTGG CAACACGGGT AATCCAGACC CTGCCATCAA CCCTTTCTAT CTTAACACTT  TACGGGGAAT TTGCCCTCGG GGAGGTAACG CCAACGCTGT AACTTCACTT GATCAACGCA CACCCGATCG CTTCGACAAC AGCTATTTCA CAAATTTGCG GATTAACGAA GGGCTCTTAC  AGTCGGATCA GGAACTCTTT TCGACCACTG GAGCATCTAC AACAGCTCTC GTGAATCTCT ACAGTAATAA CCAGATTGTT TTCTTTCAAA ACTTCCAGAA TTCCATGATA AACATGGGAA  ACATCAAGCC TCTCACGGGG AATAATGGAG AAATACGCAC CAACTGCAGG AAAGTGAACT AGTGAACATT AGATTTGCCC TTATAAAACG CTACTGCAAG TATTCTAATT TTTATTTAAT 
GAATTAGTTT ATTTCAATGC TTAC 

Retrieve as FASTA