Entry information : PnoPrxQ01
Entry ID 11202
Creation 2012-07-16 (Christophe Dunand)
Last sequence changes 2014-11-26 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information: PnoPrxQ01
Name PnoPrxQ01
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoPrxQ01
start..stop
S start..stop
GzPrxQ 238 1e-79 66..220 81..235
PcPrxQ02 112 1e-30 8..205 15..210
PcarPrxQ02 109 2e-29 8..205 15..207
CcinPrxQ 107 2e-28 88..221 95..230
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 569721..570084 364 N° 2 570144..570541 398  
join(569721..570084,570144..570541)


exon

Literature and cross-references PnoPrxQ01
DNA ref. JGI genome:   scaffold_7 (569721..570541)
Cluster/Prediction ref. JGI gene:   11136
Protein sequence: PnoPrxQ01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   253
PWM (Da):   %s   26233.64  
PI (pH):   %s   8.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVELRKRKEAPPAPVREAKKKAPAKGKKAEEKTVVEKVQETVAETVETVKEAVSDAINGEASKPAATASGKAKAGDTIDLTSFGGEIETNDGDKTTLAKLVEESKGGVVLFTYPKASTPGCTKQACLFRDSYEPLTATGYSIYGLSNDSPKANTTFKTKQKLPYTLLCDPAQTLISAIGLKKGPKGTTRGVFVVDKSGKVLAAEPGGPDATVDVVRKLVSGGAGGDNKAKEDADAAKTADEVADTAEKMDSA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCGAGCTCCGCAAGCGCAAGGAGGCTCCTCCTGCGCCAGTACGCGAGGCGAAGAAGAAGGCGCCTGCCAAGGGCAAGAAGGCTGAGGAGAAGACTGTCGTCGAAAAGGTCCAG
GAAACTGTTGCCGAGACTGTCGAGACGGTCAAGGAGGCTGTCTCTGACGCGATCAATGGCGAAGCCTCCAAGCCCGCCGCGACCGCCAGTGGAAAGGCCAAGGCCGGCGACACAATTGAC
CTGACTTCCTTCGGCGGTGAGATTGAGACAAACGACGGAGACAAGACCACGCTCGCAAAGCTTGTCGAGGAAAGCAAGGGCGGAGTTGTGCTCTTCACCTACCCCAAGGCTTCTACCCCA
GGCT
GTAAGCTACCCCTGACACTAACCCCCGTAAAGCGCATTGCTTACAAGATACTACAATAGGCACCAAGCAAGCCTGCCTCTTCCGCGATTCCTACGAACCCCTTACCGCGACCGGCT
ACAGCATCTACGGCCTCTCCAACGACAGCCCCAAAGCGAACACCACCTTCAAGACGAAGCAAAAGCTCCCTTACACGCTACTGTGTGATCCTGCACAGACGCTCATCTCAGCCATTGGCC
TGAAGAAGGGACCCAAGGGCACTACGCGCGGCGTCTTTGTCGTGGACAAGTCCGGCAAAGTGCTAGCTGCTGAGCCTGGAGGCCCTGATGCGACTGTCGATGTCGTCAGGAAGCTTGTCA
GTGGAGGCGCAGGTGGCGACAACAAGGCAAAGGAGGATGCCGACGCGGCGAAGACAGCAGACGAGGTCGCTGATACTGCGGAGAAGATGGACAGTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCGAGCTCCGCAAGCGCAAGGAGGCTCCTCCTGCGCCAGTACGCGAGGCGAAGAAGAAGGCGCCTGCCAAGGGCAAGAAGGCTGAGGAGAAGACTGTCGTCGAAAAGGTCCAG
GAAACTGTTGCCGAGACTGTCGAGACGGTCAAGGAGGCTGTCTCTGACGCGATCAATGGCGAAGCCTCCAAGCCCGCCGCGACCGCCAGTGGAAAGGCCAAGGCCGGCGACACAATTGAC
CTGACTTCCTTCGGCGGTGAGATTGAGACAAACGACGGAGACAAGACCACGCTCGCAAAGCTTGTCGAGGAAAGCAAGGGCGGAGTTGTGCTCTTCACCTACCCCAAGGCTTCTACCCCA
GGCT
GCACCAAGCAAGCCTGCCTCTTCCGCGATTCCTACGAACCCCTTACCGCGACCGGCTACAGCATCTACGGCCTCTCCAACGACAGCCCCAAAGCGAACACCACCTTCAAGACGAAG
CAAAAGCTCCCTTACACGCTACTGTGTGATCCTGCACAGACGCTCATCTCAGCCATTGGCCTGAAGAAGGGACCCAAGGGCACTACGCGCGGCGTCTTTGTCGTGGACAAGTCCGGCAAA
GTGCTAGCTGCTGAGCCTGGAGGCCCTGATGCGACTGTCGATGTCGTCAGGAAGCTTGTCAGTGGAGGCGCAGGTGGCGACAACAAGGCAAAGGAGGATGCCGACGCGGCGAAGACAGCA
GACGAGGTCGCTGATACTGCGGAGAAGATGGACAGTGCTTGA

Retrieve as FASTA