Entry information : HpulCcP02
Entry ID 11204
Creation 2012-07-18 (Christophe Dunand)
Last sequence changes 2012-07-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-15 (Catherine Mathe (Scipio))
Peroxidase information: HpulCcP02
Name HpulCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Hysteriaceae Hysterium
Organism Hysterium pulicare    [TaxId: 100027 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HpulCcP02
start..stop
S start..stop
RrufCcP02 634 0 1..368 1..371
GsteCcP02 597 0 1..370 1..374
CgeoCcP01 590 0 1..370 1..374
LpaluCcP02 588 0 1..369 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5976..6370 395 N° 2 6434..7151 718  
join(5976..6370,6434..7151)


exon

Literature and cross-references HpulCcP02
DNA ref. JGI genome:   NODE_486_length_85549_cov_26.735497 (5976..7151)
Cluster/Prediction ref. JGI gene:   8145
Protein sequence: HpulCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370
PWM (Da):   %s   40890.99  
PI (pH):   %s   8.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARTFTRSAASSFKSTAARSNARFALPQQSFRQSFRRGYSSAGPKPSGGSGNSIIFGGVAVLAAGGGFYYYKTQITSSEAKPTGPFTPKFEDYQKIYDAVAKRLEEHDEYDDGSYGPVLLRLAWHASGTFDAMTGTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKEQFPWITYSDLWILSGICAIQEMQGPHVPFRPGRSDRDMSFCTPDGRLPDASKDQNHIRAIFGRMGFNDQEMVALSGAHALGRCHTDRSGFDGPWTFSPTTLTNDYFKLLLEEKWGWKKWNGPKQFEDTKTKSLMMLPTDMALIKDKKFRSYVEKYAKDNDAFFKDFSDVVTKLFELGVPFTAGEDGRMTFQSSFDKA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCAGCCCGAACCTTCACGCGCAGTGCCGCCTCTTCCTTCAAGTCGACTGCTGCTCGCAGCAATGCCCGCTTCGCCCTTCCACAACAGTCCTTCCGCCAGTCCTTCCGCCGC
GGGTATTCCAGTGCTGGCCCGAAGCCTTCGGGTGGCAGCGGCAATAGCATCATCTTCGGTGGTGTTGCAGTTCTAGCTGCAGGCGGTGGATTCTACTACTACAAGACACAAATTACGAGT
TCAGAGGCAAAGCCTACGGGACCATTCACGCCTAAGTTCGAGGATTACCAGAAGATCTACGATGCGGTGGCAAAGCGATTGGAGGAACATGATGAATATGATGATGGAAGCTATGGACCC
GTCTTGTTGAGATTGGCATGGCACGCTTCTGGGAC
GTAAGTATACCAACTCAATTTCATCTGATGTTGAAGCATTGAGCTAATCGCTTCTGTCTACAGTTTCGACGCAATGACCGGCACA
GGTGGCTCCAACGGTGCAACCATGCGTTTCGCTCCCGAAGGCGACCACGGCGCGAACGCCGGTCTCAAAGCCGCACGCGATTTCCTCGAACCCGTGAAGGAGCAATTCCCCTGGATTACG
TACTCAGACCTCTGGATCCTATCCGGCATCTGCGCCATCCAAGAAATGCAAGGCCCACACGTTCCCTTCCGCCCAGGCCGTTCAGACCGCGACATGTCCTTCTGCACGCCCGACGGCCGA
CTACCCGATGCCTCCAAAGACCAAAACCACATCCGCGCCATCTTCGGCCGCATGGGCTTCAACGACCAGGAAATGGTTGCTTTGAGCGGCGCGCACGCTCTCGGCCGCTGCCACACCGAT
CGCTCTGGCTTCGACGGTCCATGGACGTTTTCCCCCACCACGCTCACAAACGACTACTTCAAGCTTCTGCTAGAGGAGAAGTGGGGATGGAAGAAGTGGAATGGACCGAAGCAGTTCGAG
GACACGAAGACGAAGAGCCTGATGATGCTGCCCACGGACATGGCGCTCATCAAAGACAAGAAGTTCCGATCGTACGTGGAGAAGTACGCCAAGGATAACGATGCTTTCTTCAAGGATTTC
TCCGACGTCGTGACCAAGCTGTTCGAACTCGGCGTCCCGTTCACAGCCGGCGAGGACGGGAGAATGACGTTCCAGAGCAGCTTCGATAAGGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCAGCCCGAACCTTCACGCGCAGTGCCGCCTCTTCCTTCAAGTCGACTGCTGCTCGCAGCAATGCCCGCTTCGCCCTTCCACAACAGTCCTTCCGCCAGTCCTTCCGCCGC
GGGTATTCCAGTGCTGGCCCGAAGCCTTCGGGTGGCAGCGGCAATAGCATCATCTTCGGTGGTGTTGCAGTTCTAGCTGCAGGCGGTGGATTCTACTACTACAAGACACAAATTACGAGT
TCAGAGGCAAAGCCTACGGGACCATTCACGCCTAAGTTCGAGGATTACCAGAAGATCTACGATGCGGTGGCAAAGCGATTGGAGGAACATGATGAATATGATGATGGAAGCTATGGACCC
GTCTTGTTGAGATTGGCATGGCACGCTTCTGGGAC
TTTCGACGCAATGACCGGCACAGGTGGCTCCAACGGTGCAACCATGCGTTTCGCTCCCGAAGGCGACCACGGCGCGAACGCCGGT
CTCAAAGCCGCACGCGATTTCCTCGAACCCGTGAAGGAGCAATTCCCCTGGATTACGTACTCAGACCTCTGGATCCTATCCGGCATCTGCGCCATCCAAGAAATGCAAGGCCCACACGTT
CCCTTCCGCCCAGGCCGTTCAGACCGCGACATGTCCTTCTGCACGCCCGACGGCCGACTACCCGATGCCTCCAAAGACCAAAACCACATCCGCGCCATCTTCGGCCGCATGGGCTTCAAC
GACCAGGAAATGGTTGCTTTGAGCGGCGCGCACGCTCTCGGCCGCTGCCACACCGATCGCTCTGGCTTCGACGGTCCATGGACGTTTTCCCCCACCACGCTCACAAACGACTACTTCAAG
CTTCTGCTAGAGGAGAAGTGGGGATGGAAGAAGTGGAATGGACCGAAGCAGTTCGAGGACACGAAGACGAAGAGCCTGATGATGCTGCCCACGGACATGGCGCTCATCAAAGACAAGAAG
TTCCGATCGTACGTGGAGAAGTACGCCAAGGATAACGATGCTTTCTTCAAGGATTTCTCCGACGTCGTGACCAAGCTGTTCGAACTCGGCGTCCCGTTCACAGCCGGCGAGGACGGGAGA
ATGACGTTCCAGAGCAGCTTCGATAAGGCATAA

Retrieve as FASTA