Entry information : RrufCcP02
Entry ID 11205
Creation 2012-07-18 (Christophe Dunand)
Last sequence changes 2012-07-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: RrufCcP02
Name RrufCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Patellariaceae Rhytidhysteron
Organism Rhytidhysteron rufulum    [TaxId: 37885 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RrufCcP02
start..stop
S start..stop
HpulCcP02 634 0 1..371 1..368
GsteCcP02 586 0 1..371 1..372
LpaluCcP02 581 0 1..371 1..372
CgeoCcP01 570 0 1..371 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10665..11068 404 N° 2 11126..11840 715  
join(10665..11068,11126..11840)


exon

Literature and cross-references RrufCcP02
DNA ref. JGI genome:   NODE_6131_length_35830_cov_37.699329 (10665..11840)
Cluster/Prediction ref. JGI gene:   9436
Protein sequence: RrufCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   41566.54  
PI (pH):   %s   9.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTARTLRSALRSTPTTRSFTTSRSRTHFSLPQQTFRQSFRRGYASSGPEPTPLSSGNGIIFGGIAVLAAGGGFYYYKTQYGATATPKGPFVPKFEDYQKVYNAVAKAIEEHDEYDDGSYGPVLLRLAWHASGTYDAQTGTGGSNGATMRFAPEGDHGANAGLKAARDFLEPIKQQFPWITYSDLWILAGVAAIQEMQGPHVPYRPGRQDRDVSFCTPDGRLPDASKDQKHIRNIFGRMGFNDQEMVALSGAHALGRCHTDRSGFDGPWTFSPTTLTNDYYKLLIEEKWNWKKWNGPKQFEDTKTKTLMMLPTDMALIKDKSFRQYVEKYAKDNDAFFDDFSKVIVKLFELGVPFQSSADERWVFKSSFDS

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCACGGCTCGCACTCTACGCAGCGCCCTTCGCTCAACTCCCACCACCCGCTCCTTCACCACTTCCCGAAGCCGCACCCACTTCTCCCTTCCTCAACAAACCTTTCGTCAGAGC
TTCCGCCGAGGCTACGCTTCCTCTGGTCCTGAGCCTACACCATTGAGCAGCGGCAACGGCATCATCTTCGGTGGTATCGCTGTACTTGCTGCAGGAGGAGGCTTCTACTACTACAAGACC
CAGTACGGGGCAACCGCTACACCAAAGGGTCCTTTTGTACCCAAGTTCGAGGACTACCAGAAAGTATACAATGCAGTAGCAAAGGCAATTGAGGAGCACGATGAATACGATGATGGAAGC
TATGGACCAGTGCTTCTGAGATTGGCATGGCACGCTTCTGGAAC
GTGAGTTTGCTACAACTTTCTACACCCCCATGCATCGCCACTGACGATATACCATAGTTACGATGCACAAACCGGT
ACTGGTGGTTCCAATGGAGCAACCATGCGTTTCGCCCCAGAAGGTGATCACGGTGCTAATGCCGGCCTCAAGGCCGCCCGTGACTTCCTTGAGCCCATCAAACAGCAATTCCCCTGGATA
ACCTACTCCGATCTCTGGATTCTTGCCGGTGTTGCAGCCATCCAAGAGATGCAAGGTCCCCACGTCCCATATCGTCCAGGTCGTCAAGACCGTGACGTCTCCTTCTGTACTCCTGACGGT
CGTCTCCCCGATGCTTCCAAGGATCAGAAACACATCCGTAACATCTTTGGCCGCATGGGTTTCAATGACCAAGAAATGGTTGCTCTGAGTGGAGCTCACGCTCTTGGCCGCTGCCACACT
GACCGATCTGGATTTGATGGTCCATGGACTTTCTCTCCTACCACCCTCACAAACGACTACTACAAGCTCCTCATTGAGGAGAAGTGGAACTGGAAGAAGTGGAACGGTCCCAAGCAATTT
GAGGACACCAAGACCAAGACCTTGATGATGCTGCCAACCGATATGGCACTCATCAAAGACAAGAGCTTCAGGCAGTACGTAGAGAAGTACGCCAAGGACAACGACGCTTTCTTTGATGAT
TTCTCAAAAGTAATCGTCAAGCTTTTCGAGCTCGGCGTACCATTCCAGAGTTCGGCAGACGAGAGATGGGTATTCAAGAGCAGCTTCGACTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCACGGCTCGCACTCTACGCAGCGCCCTTCGCTCAACTCCCACCACCCGCTCCTTCACCACTTCCCGAAGCCGCACCCACTTCTCCCTTCCTCAACAAACCTTTCGTCAGAGC
TTCCGCCGAGGCTACGCTTCCTCTGGTCCTGAGCCTACACCATTGAGCAGCGGCAACGGCATCATCTTCGGTGGTATCGCTGTACTTGCTGCAGGAGGAGGCTTCTACTACTACAAGACC
CAGTACGGGGCAACCGCTACACCAAAGGGTCCTTTTGTACCCAAGTTCGAGGACTACCAGAAAGTATACAATGCAGTAGCAAAGGCAATTGAGGAGCACGATGAATACGATGATGGAAGC
TATGGACCAGTGCTTCTGAGATTGGCATGGCACGCTTCTGGAAC
TTACGATGCACAAACCGGTACTGGTGGTTCCAATGGAGCAACCATGCGTTTCGCCCCAGAAGGTGATCACGGTGCT
AATGCCGGCCTCAAGGCCGCCCGTGACTTCCTTGAGCCCATCAAACAGCAATTCCCCTGGATAACCTACTCCGATCTCTGGATTCTTGCCGGTGTTGCAGCCATCCAAGAGATGCAAGGT
CCCCACGTCCCATATCGTCCAGGTCGTCAAGACCGTGACGTCTCCTTCTGTACTCCTGACGGTCGTCTCCCCGATGCTTCCAAGGATCAGAAACACATCCGTAACATCTTTGGCCGCATG
GGTTTCAATGACCAAGAAATGGTTGCTCTGAGTGGAGCTCACGCTCTTGGCCGCTGCCACACTGACCGATCTGGATTTGATGGTCCATGGACTTTCTCTCCTACCACCCTCACAAACGAC
TACTACAAGCTCCTCATTGAGGAGAAGTGGAACTGGAAGAAGTGGAACGGTCCCAAGCAATTTGAGGACACCAAGACCAAGACCTTGATGATGCTGCCAACCGATATGGCACTCATCAAA
GACAAGAGCTTCAGGCAGTACGTAGAGAAGTACGCCAAGGACAACGACGCTTTCTTTGATGATTTCTCAAAAGTAATCGTCAAGCTTTTCGAGCTCGGCGTACCATTCCAGAGTTCGGCA
GACGAGAGATGGGTATTCAAGAGCAGCTTCGACTCATAG

Retrieve as FASTA