Entry information : OsPrx111
Entry ID 1121
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2010-08-03 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx111
Name OsPrx111
Class Class III peroxidase    [Orthogroup: Prx060]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Coleoptiles
Flowers
Leaves
Radicles
Roots
Stems
Inducers Magnaporthe grisea infection
Methyl jasmonate treatment
Pathogen interaction
Salicylic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx111
start..stop
S start..stop
OruPrx111 640 0 1..317 1..317
OsPrx112 549 0 1..316 1..314
OsPrx114 497 2e-179 1..317 1..311
SiPrx120 479 7e-172 7..316 43..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28620244..28620459 216 N° 2 28620556..28620732 177 N° 3 28620819..28620984 166 N° 4 28621099..28621493 395
join(28620244..28620459,28620556..28620732,28620819..28620984,28621099..28621493 )


exon

Literature and cross-references OsPrx111
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q43006   Q7F1U0 [Mismatch]   A3BNE0 [Incorrect splicing]   Q5U1I2 [Incorrect splicing]
DNA ref. GenBank:   NC_008400.1 (28620244..28621490)
Cluster/Prediction ref. UniGene:   Os.22086
Protein sequence: OsPrx111
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (292)
PWM (Da):   %s   32782.11 (30432.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.1 (6.10) Peptide Signal:   %s   cut: 26 range:26-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASATNSSLSLMLLVAAAMASVASAQLSATFYDTSCPNALSTIKSVITAAVNSEARMGASLLRLHFHDCFVQGCDASVLLSGQEQNAGPNVGSLRGFSVIDNAKARVEAICNQTVSCADILAVAARDSVVALGGPSWTVLLGRRDSTTASEALANTDLPAPSSSLAELIGNFSRKGLDATDMVALSGAHTIGQAQCQNFRDRIYNETNIDSAFATQRQANCPRPTGSGDSNLAPLDTTTPNAFDNAYYSNLLSNKGLLHSDQVLFNGGSADNTVRNFASNAAAFSSAFTTAMVKMGNISPLTGTQGQIRLSCSKVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 3 introns) 8 mRNA and 98 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGCAACTAATTCTTCACTTAGCTTAATGCTGCTGGTGGCTGCAGCTATGGCGTCAGTGGCATCGGCGCAGCTCTCGGCGACGTTCTATGACACGTCGTGCCCCAATGCGTTG
TCCACCATCAAGAGCGTCATAACAGCCGCCGTGAACAGCGAGGCTCGCATGGGGGCGTCGCTGCTCAGGCTGCACTTCCACGACTGCTTCGTCCAA
GCAAGTTTCACACAACCAATTGTA
CTAATTTTCATGAAATTATAGTATATTTCGGACGAGAAAATAACAGAGAACATATATCTAAAATCACTGCAGGGGTGCGACGCGTCAGTTCTGCTGTCCGGGCAGGAGCAGAATGCTGGC
CCGAACGTGGGGTCGCTGAGGGGATTCAGCGTCATCGACAACGCCAAGGCGCGGGTGGAGGCCATCTGCAACCAGACCGTCTCCTGCGCCGACATCCTCGCCGTCGCCGCCCGTGACTCC
GTCGTCGCG
GTAAGAATGTCACAGCCCTTCGATCGCCCGTGACTTTCTTTCTGTTGTTCTTTCACTGATAGAGCTAGCTCCCTCTTGGTTCGCAGCTGGGAGGGCCATCATGGACGGTTC
TGTTGGGGAGAAGGGACTCCACCACTGCAAGCGAGGCCTTGGCAAATACCGACCTCCCTGCCCCTTCCTCTAGCCTCGCAGAACTTATCGGCAATTTCTCCAGAAAGGGACTCGACGCAA
CCGACATGGTTGCTCTCTCAG
GTAATCCGATATGGAGTATTATATACGAGTATATATATAGATAGATTAGGATACCATGTATATATGTGTTGCAGATTTTCTGATAAGATGAGAGCGCGA
TTAATTATTTCGCAGGAGCACACACGATCGGGCAGGCGCAGTGCCAGAATTTCAGGGACAGGATCTACAACGAGACCAACATCGATTCCGCCTTCGCGACGCAACGCCAGGCCAACTGCC
CACGGCCGACGGGCAGCGGCGACAGCAACCTGGCGCCGCTGGACACGACGACGCCCAACGCCTTCGACAACGCCTACTACAGCAACCTGCTGTCCAACAAGGGGCTCCTGCACTCCGACC
AGGTGCTCTTCAACGGCGGCAGCGCGGACAACACGGTCAGGAACTTCGCGTCCAACGCGGCGGCGTTCAGCAGCGCCTTCACGACGGCCATGGTGAAGATGGGGAACATCTCGCCGCTGA
CCGGGACGCAGGGGCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTGCAACTAATTCTTCACTTAGCTTAATGCTGCTGGTGGCTGCAGCTATGGCGTCAGTGGCATCGGCGCAGCTCTCGGCGACGTTCTATGACACGTCGTGCCCCAATGCGTTG
TCCACCATCAAGAGCGTCATAACAGCCGCCGTGAACAGCGAGGCTCGCATGGGGGCGTCGCTGCTCAGGCTGCACTTCCACGACTGCTTCGTCCAA
GGGTGCGACGCGTCAGTTCTGCTG
TCCGGGCAGGAGCAGAATGCTGGCCCGAACGTGGGGTCGCTGAGGGGATTCAGCGTCATCGACAACGCCAAGGCGCGGGTGGAGGCCATCTGCAACCAGACCGTCTCCTGCGCCGACATC
CTCGCCGTCGCCGCCCGTGACTCCGTCGTCGCG
CTGGGAGGGCCATCATGGACGGTTCTGTTGGGGAGAAGGGACTCCACCACTGCAAGCGAGGCCTTGGCAAATACCGACCTCCCTGCC
CCTTCCTCTAGCCTCGCAGAACTTATCGGCAATTTCTCCAGAAAGGGACTCGACGCAACCGACATGGTTGCTCTCTCAG
GAGCACACACGATCGGGCAGGCGCAGTGCCAGAATTTCAGG
GACAGGATCTACAACGAGACCAACATCGATTCCGCCTTCGCGACGCAACGCCAGGCCAACTGCCCACGGCCGACGGGCAGCGGCGACAGCAACCTGGCGCCGCTGGACACGACGACGCCC
AACGCCTTCGACAACGCCTACTACAGCAACCTGCTGTCCAACAAGGGGCTCCTGCACTCCGACCAGGTGCTCTTCAACGGCGGCAGCGCGGACAACACGGTCAGGAACTTCGCGTCCAAC
GCGGCGGCGTTCAGCAGCGCCTTCACGACGGCCATGGTGAAGATGGGGAACATCTCGCCGCTGACCGGGACGCAGGGGCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCCTAA

Retrieve as FASTA