Entry information : AqNAnPrx01 ( AqPOX)
Entry ID 11256
Creation 2012-08-16 (Marcel Zamocky)
Last sequence changes 2016-02-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-23 (Achraf Jemmat)
Peroxidase information: AqNAnPrx01 ( AqPOX)
Name (synonym) AqNAnPrx01 ( AqPOX)
Class Other non animal peroxidase    [Orthogroup: NAnPrx001]
Taxonomy Eukaryota Metazoa Porifera Demospongiae Niphatidae Amphimedon
Organism Amphimedon queenslandica (sponge)    [TaxId: 400682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AqNAnPrx01
start..stop
S start..stop
MviNAnPrx01 149 2e-41 1..340 1..317
HviNAnPrx01 137 2e-37 7..339 4..329
HvuNAnPrx03 137 3e-37 25..339 26..327
HvuNAnPrx05 133 1e-35 58..352 81..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2016..2171 156 N° 2 1002..1685 684 N° 3 501..845 345  
complement(join(501..845,1002..1685,2016..2171))


exon

Literature and cross-references AqNAnPrx01 ( AqPOX)
Literature Srivastava, M., Simakov, O., Chapman, J., Fahey, B. et al. (2010) The Amphimedon queenslandica genome and the evolution of animal complexity. Nature 466:720-727
Protein ref. UniProtKB:   I1FCZ8
DNA ref. GenBank:   NW_003546550.1 (91346..94016)
Cluster/Prediction ref. Genebank:   100640460
Protein sequence: AqNAnPrx01 ( AqPOX)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   394 (375)
PWM (Da):   %s   42656.35 (40540.4)  
PI (pH):   %s   4.56 (4.56) Peptide Signal:   %s   cut: 20 range:20-394
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSFCVVFLFSYLSLAFSQSVTVETEARAIADINAFIANNTNTGNQPEINNPAAKLVRLAFHDCPGGCDGCLNFENPENNGLMETYTIINGIFDRNGYAAEGMSRADFVALAGVIAIEAASMRQDCRMMPPNSTCPLVPTMTLKYGRRDCQTSPRTDDIEPFPVAHGDLSHVLMYFRDNMNMSTRETVAIIGAHSLGTTRLQNSGFRGPWAPPTDRFDNGFYRILFGGGNARWMQEEVNDTRSSVFPDSRYQWTRPGPGNGGPGPGNGGGPVIMLNSDMALLRDIDPDSDGRESNASCRMNSNNCEESMLTFNMVREFAMNNSAFIEAFGPAFQKLIETGYHGTNALYTAEEVVPTSSSPMPTPTESSTPSAGVGLKAVLLLTLSLFVLAVFA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCAGCTTCTGTGTTGTTTTTCTCTTCTCTTACCTTTCTCTTGCTTTCTCTCAATCTGTGACAGTAGAGACAGAGGCCAGAGCTATTGCTGACATTAATGCTTTCATTGCTAAC
AACACCAACACTGGGAATCAACCTGAAATTAATAAT
GTAAGACTCACTATAATAATAGTTTGACATAATAATTATAGTTTTTGTATCACTGCATGAGTGCCTTGATGGTGCAATGGAGCA
TAAATATCAGAGTAAACGTGCATTGTCCCATTTATGAATACTTCTCTTAGTACCATGATAGCAATAGCAGTTTACTTTCAGTTACGGTATCATATCAAAGCCTTGGGTGGGGCTCCCTAT
GCCTACAGGCCACTTTCTACATCTCAGCTTTAAATTTTAAAATTGTTTTTTTGCTTTGCTGTTTGTTATTTTAATAAAAATTGATGCCAAAACTGTCTATAAATGTATTTATTCTTTCCT
TTACAGCCAGCTGCTAAACTAGTCCGTCTTGCCTTTCATGATTGCCCAGGTGGATGTGATGGCTGCCTCAACTTTGAGAATCCTGAAAACAATGGACTAATGGAGACATACACTATTATC
AATGGGATATTTGATCGTAATGGCTATGCAGCAGAGGGAATGTCACGAGCTGATTTTGTTGCTTTAGCTGGTGTCATTGCAATAGAAGCTGCATCAATGCGGCAAGACTGTAGAATGATG
CCACCTAATTCAACCTGTCCACTTGTTCCTACTATGACACTCAAATATGGTCGCAGAGACTGCCAAACGTCTCCAAGAACAGATGATATTGAACCATTTCCAGTTGCTCATGGCGACCTG
AGTCACGTACTGATGTACTTTCGGGATAACATGAACATGAGCACTCGTGAGACTGTAGCCATTATAGGAGCCCACAGTCTGGGGACTACCAGACTACAGAACAGTGGGTTTAGAGGCCCT
TGGGCTCCACCGACTGATAGGTTTGATAATGGGTTCTATCGTATTTTATTTGGTGGTGGTAATGCAAGGTGGATGCAAGAGGAGGTCAACGACACTCGTAGCTCAGTGTTCCCTGATTCA
AGATACCAATGGACTAGGCCTGGCCCTGGTAATGGTGGACCTGGTCCTGGTAATGGTGGTGGACCTGTTATCATGTTGAACAGTGACATG
GTAAGTGCTAGCTATGCATAATAAGATACA
GCACATGCTCATCACATGCATGGATTCTTTTGATAGTAAGCATATTTTGTTGGGTAAACATTGTAGTAGCTATAGTTACATTCTTTACATTACTATAGCATTGATTGGCAGTGTTTTATT
CCATAGGCTTTACTGAGGGACATTGATCCTGATTCTGATGGACGTGAGTCTAATGCTTCTTGTCGAATGAACTCAAACAATTGTGAAGAATCAATGCTCACCTTTAACATGGTGAGGGAG
TTTGCCATGAACAACAGTGCATTCATAGAGGCATTTGGACCCGCCTTCCAGAAACTAATAGAAACTGGTTACCATGGGACTAATGCTCTTTATACTGCAGAAGAAGTTGTTCCTACATCA
TCATCACCTATGCCAACCCCTACTGAGTCATCCACTCCTAGTGCTGGTGTTGGCTTGAAAGCAGTTCTGCTACTCACTCTATCTCTCTTTGTACTAGCTGTCTTTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCAGCTTCTGTGTTGTTTTTCTCTTCTCTTACCTTTCTCTTGCTTTCTCTCAATCTGTGACAGTAGAGACAGAGGCCAGAGCTATTGCTGACATTAATGCTTTCATTGCTAAC
AACACCAACACTGGGAATCAACCTGAAATTAATAAT
CCAGCTGCTAAACTAGTCCGTCTTGCCTTTCATGATTGCCCAGGTGGATGTGATGGCTGCCTCAACTTTGAGAATCCTGAAAAC
AATGGACTAATGGAGACATACACTATTATCAATGGGATATTTGATCGTAATGGCTATGCAGCAGAGGGAATGTCACGAGCTGATTTTGTTGCTTTAGCTGGTGTCATTGCAATAGAAGCT
GCATCAATGCGGCAAGACTGTAGAATGATGCCACCTAATTCAACCTGTCCACTTGTTCCTACTATGACACTCAAATATGGTCGCAGAGACTGCCAAACGTCTCCAAGAACAGATGATATT
GAACCATTTCCAGTTGCTCATGGCGACCTGAGTCACGTACTGATGTACTTTCGGGATAACATGAACATGAGCACTCGTGAGACTGTAGCCATTATAGGAGCCCACAGTCTGGGGACTACC
AGACTACAGAACAGTGGGTTTAGAGGCCCTTGGGCTCCACCGACTGATAGGTTTGATAATGGGTTCTATCGTATTTTATTTGGTGGTGGTAATGCAAGGTGGATGCAAGAGGAGGTCAAC
GACACTCGTAGCTCAGTGTTCCCTGATTCAAGATACCAATGGACTAGGCCTGGCCCTGGTAATGGTGGACCTGGTCCTGGTAATGGTGGTGGACCTGTTATCATGTTGAACAGTGACATG
GCTTTACTGAGGGACATTGATCCTGATTCTGATGGACGTGAGTCTAATGCTTCTTGTCGAATGAACTCAAACAATTGTGAAGAATCAATGCTCACCTTTAACATGGTGAGGGAGTTTGCC
ATGAACAACAGTGCATTCATAGAGGCATTTGGACCCGCCTTCCAGAAACTAATAGAAACTGGTTACCATGGGACTAATGCTCTTTATACTGCAGAAGAAGTTGTTCCTACATCATCATCA
CCTATGCCAACCCCTACTGAGTCATCCACTCCTAGTGCTGGTGTTGGCTTGAAAGCAGTTCTGCTACTCACTCTATCTCTCTTTGTACTAGCTGTCTTTGCTTGA

Retrieve as FASTA