Entry information : OsPrx118
Entry ID 1128
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx118
Name OsPrx118
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Pannicles
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx118
start..stop
S start..stop
SbPrx103 526 0 21..367 24..369
TaPrx22-1A 521 0 26..367 22..348
BdiPrx105 520 0 28..367 27..368
ZmPrx32 518 0 5..367 7..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12448808..12449122 315 N° 2 12449218..12449409 192 N° 3 12449520..12449685 166 N° 4 12449771..12450201 431
join(12448808..12449122,12449218..12449409,12449520..12449685,12449771..12450201 )


exon

Literature and cross-references OsPrx118
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6UU25
DNA ref. GenBank:   NC_008401.1 (12448808..12450198)
Protein sequence: OsPrx118
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (342)
PWM (Da):   %s   36791.58 (34412.3) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.75 (4.84) Peptide Signal:   %s   cut: 26 range:26-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDQLLALAVAVPLFALASALAAASATPVNKSCLNGSTGAAVSIGYGGASASAGAGAGVSLGTDAYWLACPLAEEIVRDVVERAVAADPRMAASLLRLHFHDCFVNGCDGSVLLDDKPLFIGEKTAGPNANSLRGFEVIDAIKAELENACPETVSCADVLAIAARDSVVASGGPSWQVEVGRKDSRTASLQGANTNLPAPTSGVATLVQKFRNVGLSAKDMVALSGAHTIGKARCTTFSARLAGVGASAGGGATPGDLSFLESLHQLCAVSAGSALAHLDLVTPATFDNQYYVNLLSGEGLLPSDQALASAGAAAAGAEDVAGLIAAYAFDALLFFDDFASSMLRMGRLAPGAGTASGEVRRNCRVVN

Retrieve as FASTA  
Remarks chromosome 8. 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCAGCTGCTGGCCCTGGCGGTGGCAGTCCCGCTGTTTGCTCTTGCCAGTGCACTTGCTGCTGCCTCTGCTACGCCGGTCAACAAGTCCTGCCTCAATGGTAGCACCGGCGCCGCC
GTCAGCATAGGGTACGGTGGTGCCAGCGCTAGCGCTGGCGCCGGCGCCGGCGTGTCTCTTGGCACCGACGCGTACTGGTTGGCCTGCCCACTTGCCGAGGAGATCGTCCGCGACGTCGTG
GAGAGGGCTGTCGCCGCCGACCCCCGCATGGCGGCGTCCCTCCTCCGTCTCCACTTCCACGACTGCTTTGTCAAT
GTGATTATCTTTCTGTTTGCCGCGCTACATGTGTGAAGTGGTCGT
CACTCGTCAGGGCCATTGATGTGAGCATGTCGATGTGTGTTTTTTGCTAGGGCTGTGATGGCTCCGTGCTCTTGGACGACAAGCCGTTATTCATCGGCGAGAAGACGGCCGGGCCGAACG
CAAACTCGCTCCGGGGATTCGAGGTTATCGACGCCATCAAAGCCGAGCTCGAGAACGCGTGCCCGGAGACCGTCTCCTGCGCTGACGTCCTCGCCATCGCCGCGCGCGACTCTGTCGTGG
CA
GTAAGCCATATCTAGCTAATAGCCAAGCAGATATATACCACGCATGTGTGTAAACCATCCAAACTGTAATTGTTGCTCACGTTGTGGTTGTGTCTTTTTCGAATGATCAGTCAGGCGG
GCCGAGCTGGCAGGTGGAAGTCGGCCGGAAGGACAGCCGCACGGCGAGCCTGCAGGGCGCCAACACCAACCTCCCGGCGCCCACGTCCGGCGTCGCCACCCTCGTGCAGAAGTTCCGGAA
CGTTGGCCTCTCGGCCAAAGACATGGTCGCTCTCTCCG
GTAACCAAGGCTCCTCCATCTTCGAATTCGAATACGTTACAGATAGCTCGCATATGTTCATGGATTGCGTCCATGCATGACG
CAGGCGCGCACACCATTGGTAAGGCGCGGTGCACGACGTTCAGCGCACGCCTCGCTGGCGTCGGCGCCTCGGCCGGCGGCGGTGCCACTCCAGGTGACCTTTCGTTCCTCGAGTCACTGC
ACCAGCTGTGCGCAGTGTCCGCCGGCTCGGCGCTGGCGCACCTGGACCTTGTCACGCCGGCCACTTTCGACAACCAGTACTACGTCAACCTGCTCTCCGGCGAGGGCTTGCTGCCGTCCG
ACCAGGCGCTGGCCTCGGCCGGAGCAGCTGCTGCCGGGGCGGAGGACGTGGCCGGCCTCATCGCAGCCTACGCTTTCGATGCGTTGCTCTTCTTCGACGACTTCGCATCATCTATGCTAC
GGATGGGGAGGCTGGCGCCGGGAGCGGGCACCGCCTCCGGCGAGGTCCGCCGCAACTGCCGGGTGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCAGCTGCTGGCCCTGGCGGTGGCAGTCCCGCTGTTTGCTCTTGCCAGTGCACTTGCTGCTGCCTCTGCTACGCCGGTCAACAAGTCCTGCCTCAATGGTAGCACCGGCGCCGCC
GTCAGCATAGGGTACGGTGGTGCCAGCGCTAGCGCTGGCGCCGGCGCCGGCGTGTCTCTTGGCACCGACGCGTACTGGTTGGCCTGCCCACTTGCCGAGGAGATCGTCCGCGACGTCGTG
GAGAGGGCTGTCGCCGCCGACCCCCGCATGGCGGCGTCCCTCCTCCGTCTCCACTTCCACGACTGCTTTGTCAAT
GGCTGTGATGGCTCCGTGCTCTTGGACGACAAGCCGTTATTCATC
GGCGAGAAGACGGCCGGGCCGAACGCAAACTCGCTCCGGGGATTCGAGGTTATCGACGCCATCAAAGCCGAGCTCGAGAACGCGTGCCCGGAGACCGTCTCCTGCGCTGACGTCCTCGCC
ATCGCCGCGCGCGACTCTGTCGTGGCA
TCAGGCGGGCCGAGCTGGCAGGTGGAAGTCGGCCGGAAGGACAGCCGCACGGCGAGCCTGCAGGGCGCCAACACCAACCTCCCGGCGCCCACG
TCCGGCGTCGCCACCCTCGTGCAGAAGTTCCGGAACGTTGGCCTCTCGGCCAAAGACATGGTCGCTCTCTCCG
GCGCGCACACCATTGGTAAGGCGCGGTGCACGACGTTCAGCGCACGC
CTCGCTGGCGTCGGCGCCTCGGCCGGCGGCGGTGCCACTCCAGGTGACCTTTCGTTCCTCGAGTCACTGCACCAGCTGTGCGCAGTGTCCGCCGGCTCGGCGCTGGCGCACCTGGACCTT
GTCACGCCGGCCACTTTCGACAACCAGTACTACGTCAACCTGCTCTCCGGCGAGGGCTTGCTGCCGTCCGACCAGGCGCTGGCCTCGGCCGGAGCAGCTGCTGCCGGGGCGGAGGACGTG
GCCGGCCTCATCGCAGCCTACGCTTTCGATGCGTTGCTCTTCTTCGACGACTTCGCATCATCTATGCTACGGATGGGGAGGCTGGCGCCGGGAGCGGGCACCGCCTCCGGCGAGGTCCGC
CGCAACTGCCGGGTGGTGAACTAG

Retrieve as FASTA