Entry information : HaPrx25 (HanXRQChr11g0325571/ HaT13l051957_1)
Entry ID 11297
Creation 2012-09-10 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx25 (HanXRQChr11g0325571/ HaT13l051957_1)
Name (synonym) HaPrx25 (HanXRQChr11g0325571/ HaT13l051957_1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx25
start..stop
S start..stop
HaPrx26 545 0 17..331 12..326
HaPrx27 532 0 9..330 8..324
LsPrx09 525 0 1..296 1..297
CclPrx35 519 0 9..330 5..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22676488..22676712 225 N° 2 22676810..22677001 192 N° 3 22677163..22677328 166 N° 4 22677407..22677819 413
join(22676488..22676712,22676810..22677001,22677163..22677328,22677407..22677819 )


exon

Literature and cross-references HaPrx25 (HanXRQChr11g0325571/ HaT13l051957_1)
DNA ref. HanXRQ genome:   HanXRQChr11 (22676488..22677819)
Cluster/Prediction ref. HanXRQ:   HanXRQChr11g0325571
Protein sequence: HaPrx25 (HanXRQChr11g0325571/ HaT13l051957_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   36209.27 (33495.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.47 (8.55) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHYINNAVLLLLASSLVLCFSPATAASVLYPQFYDFSCPQANDIVKSVVSKAVAREPRMAASLLRLHFHDCFVKGCDGSILLDGSGTITSEKRSVPNRDSARGFEVIDEIKSAIEKACPQTVSCADILALAARDSTVLTGGPSWDVPLGRRDSLGASLSGSNQNIPAPNNTFQTILTKFKLKGLDIVDFVALSGSHTIGNARCTSFRQRLYNNTGNGQPDFKLEQSYAARLRVNCPRTGGDQNLFPMDPGSPTKFDNGYYKNLMALRGLLSSDEILYTQNQETYDLVKHYAENQDDFFKQFAKSMIKMGNITPLTGNHGEIRKICRRINN

Retrieve as FASTA  
Remarks Complete sequence from genomic and EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTACATTAACAATGCAGTCCTTTTACTACTGGCTTCATCTCTTGTACTTTGCTTTTCTCCGGCGACAGCCGCTAGCGTTCTCTACCCGCAGTTCTACGACTTCTCGTGCCCA
CAAGCCAATGACATCGTTAAATCCGTTGTTTCAAAGGCGGTTGCAAGAGAACCGCGTATGGCGGCTTCTTTGCTCCGCCTTCATTTCCATGATTGTTTTGTCAAG
GTTTACATATATAAC
ATAACTAAAAGTGGAACTCATGATCCCCAAAGATATTCATTTTGATGCAAGTGTAACTTATGTTTTGACACTATTAATGCAGGGTTGTGATGGGTCAATACTTCTAGATGGCAGTGGAAC
CATAACCAGTGAGAAGAGATCGGTCCCTAACCGTGACTCGGCTCGTGGGTTCGAAGTCATTGACGAGATCAAATCCGCGATCGAGAAAGCGTGTCCCCAAACCGTCTCTTGTGCTGATAT
CTTGGCTTTGGCAGCTAGAGACTCGACTGTTTTG
GTACGGTAACTTAGGGATACCATTTATCGACCTTTTTATACTATATAATTTATTCCGAAGGGATCAAATAATCCTCGTCGGGTCAA
CCTAACGTCCTAACCGGACCTCATTTGGCGTGAATCCATCTCGGGTGGCTTATTTTTCATGTTTGGTTTATGCAGACTGGTGGGCCGAGCTGGGACGTCCCTTTAGGAAGAAGGGACTCG
TTAGGCGCGAGTTTGAGCGGCTCAAACCAGAATATACCAGCCCCAAACAACACCTTCCAGACCATCCTCACTAAATTCAAACTCAAGGGTCTCGACATCGTTGATTTTGTAGCTCTTTCG
G
GTAATCTCAAAAGTCGATAAACGAACGCAAAAAAAATATATATTTTTTCAAGAAAAATGCTTACTCGTTGTGTTGCAGGAAGTCACACCATCGGAAACGCTAGGTGCACCAGCTTTAGA
CAAAGGTTGTACAACAACACGGGTAACGGGCAACCCGACTTCAAATTAGAGCAATCATATGCTGCCCGACTGCGTGTCAACTGCCCGAGAACCGGTGGCGATCAAAACCTGTTTCCGATG
GACCCTGGTTCACCTACGAAGTTTGATAACGGATACTACAAGAACTTGATGGCTTTAAGGGGCCTGTTAAGCTCAGATGAAATCCTCTATACGCAAAACCAAGAAACGTACGATTTGGTA
AAACATTACGCCGAGAATCAAGACGATTTTTTCAAGCAGTTTGCAAAGTCTATGATCAAGATGGGGAATATAACTCCGTTAACCGGTAACCATGGAGAGATCAGAAAGATTTGCAGGAGG
ATCAACAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACTACATTAACAATGCAGTCCTTTTACTACTGGCTTCATCTCTTGTACTTTGCTTTTCTCCGGCGACAGCCGCTAGCGTTCTCTACCCGCAGTTCTACGACTTCTCGTGCCCA
CAAGCCAATGACATCGTTAAATCCGTTGTTTCAAAGGCGGTTGCAAGAGAACCGCGTATGGCGGCTTCTTTGCTCCGCCTTCATTTCCATGATTGTTTTGTCAAG
GGTTGTGATGGGTCA
ATACTTCTAGATGGCAGTGGAACCATAACCAGTGAGAAGAGATCGGTCCCTAACCGTGACTCGGCTCGTGGGTTCGAAGTCATTGACGAGATCAAATCCGCGATCGAGAAAGCGTGTCCC
CAAACCGTCTCTTGTGCTGATATCTTGGCTTTGGCAGCTAGAGACTCGACTGTTTTG
ACTGGTGGGCCGAGCTGGGACGTCCCTTTAGGAAGAAGGGACTCGTTAGGCGCGAGTTTGAGC
GGCTCAAACCAGAATATACCAGCCCCAAACAACACCTTCCAGACCATCCTCACTAAATTCAAACTCAAGGGTCTCGACATCGTTGATTTTGTAGCTCTTTCGG
GAAGTCACACCATCGGA
AACGCTAGGTGCACCAGCTTTAGACAAAGGTTGTACAACAACACGGGTAACGGGCAACCCGACTTCAAATTAGAGCAATCATATGCTGCCCGACTGCGTGTCAACTGCCCGAGAACCGGT
GGCGATCAAAACCTGTTTCCGATGGACCCTGGTTCACCTACGAAGTTTGATAACGGATACTACAAGAACTTGATGGCTTTAAGGGGCCTGTTAAGCTCAGATGAAATCCTCTATACGCAA
AACCAAGAAACGTACGATTTGGTAAAACATTACGCCGAGAATCAAGACGATTTTTTCAAGCAGTTTGCAAAGTCTATGATCAAGATGGGGAATATAACTCCGTTAACCGGTAACCATGGA
GAGATCAGAAAGATTTGCAGGAGGATCAACAATTAG

Retrieve as FASTA