Entry information : HaPrx27 (HanXRQChr16g0530751/HaT13l046078_1)
Entry ID 11299
Creation 2012-09-11 (Christophe Dunand)
Last sequence changes 2016-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx27 (HanXRQChr16g0530751/HaT13l046078_1)
Name (synonym) HaPrx27 (HanXRQChr16g0530751/HaT13l046078_1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx27
start..stop
S start..stop
HaPrx26 612 0 1..324 1..325
LsaPrx08 567 0 1..324 1..324
HaPrx25 530 0 21..324 27..330
EglPrx137 520 0 21..324 32..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 177621091..177621297 207 N° 2 177620037..177620228 192 N° 3 177619779..177619944 166 N° 4 177618251..177618663 413
complement(join(177618251..177618663,177619779..177619944,177620037..177620228,1 77621091..177621297))


exon

Literature and cross-references HaPrx27 (HanXRQChr16g0530751/HaT13l046078_1)
DNA ref. HanXRQ genome:   HanXRQChr16 (177621297..177618251)
Cluster/Prediction ref. HanXRQ:   HanXRQChr16g0530751
Protein sequence: HaPrx27 (HanXRQChr16g0530751/HaT13l046078_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (304)
PWM (Da):   %s   35703.98 (33487.8)  
PI (pH):   %s   8.09 (7.89) Peptide Signal:   %s   cut: 22 range:22-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSITMLMVLISILTLANGSYLYPQFYDISCPQAKHIVRCVVEKAVAKEARMAASLLRLHFHDCFVKGCDASILLDNSGTIVSEKGSVPNRNSARGFEVIDEIKAALEEACPQTVSCADIMALAARDSTVLTGGPSWEVPLGRRDSLGASLSGSNQNIPAPNNTLQTILTKFKLKGLDIVDFVALSGSHTIGNARCTSFRQRLYNNMGMVHPDFSLDQSYDVELRQNCPRSGGDQNLFVLDPVSPTKFDNGYYKNLIAKRGLLSSDEILFTQSQQTMEFVKQYAENQELFFQQFAKSMVKMGNITPLTGECGQIRKTCRKVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic and EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGGTCGTCAATCACCATGCTCATGGTTCTAATCTCTATCTTGACTCTAGCCAATGGCTCTTACCTCTACCCTCAGTTTTATGACATCTCATGTCCGCAAGCTAAACACATCGTC
AGGTGTGTCGTCGAAAAAGCTGTTGCAAAAGAGGCTCGTATGGCTGCTTCTTTGCTCAGGCTCCATTTCCACGATTGTTTTGTCAAG
GTTTGTTCTTCATAAGTATCGCCACTACTAAAC
TCTGCTACCCTTTGTGTTGAAAGTATTTGGTAACTAGTCACAAGTCCTTAGCGACAGCAGATTCTTGCAATGAGAAAAGTGTTTTAGTGGAACTATATGCAGTTTGCAATATTGTTATTT
TTTTTCTTCTTTTAGAAATCGTATAAAAAATGTGTGTCGTCGTATTCTCACATGTTATCCTAGATAACAAAATGATTTTTCTTTACGAAAAGGTTCCGTTACGACCTAAAAAGGTTGAGC
GGAGCATGAGTGAAAGTTAACCAAAGATTTTTATATTAGGATGTATCATTGAGTAGCAAACAAAACTAAGACCATGACTAATGGGCATTATAGGAGCGTGAAGTGATTTGATAACGCCTC
CAACACCACCCTCGTTGGCGTTATACAGACATAAAGAGGGAGGAGCATTTCTACTATAATGTCAAATGGGGAGAAAAAAGATGAAAAGTAATGATTGAATCGCCATTAAGGGACGTTAAC
CATTACACATTTTTTAAAAGACCACTATGATGCTGATGTGTCGAAAAATGCCTAAAGGGTGACAATAAAGATTAAAATTGTCATGAAAGTTATATTAACATTTTAAGTCGCCATATGAAC
ATTACAAGTCATTAGTTACCAAGATAACCTTAGTAGTAAGTTAGTAACACAAAGGAAACATGTATTAAATTAGTGACGTCTTAGCTGTTCCGAATGATGAGATGGTCATCTCAATACCTC
TTGGGTTGTAGTGTTTATATACAGGAAATTATAATTAATTTATATCCAAAGTGTTGTTACATTGATCAGGAACTTACTTTTTTTTTTTGCAACAAAAATAATCAATTAGGGGTGCGATGC
TTCGATACTTCTTGACAACAGTGGAACCATAGTCAGCGAGAAGGGATCCGTCCCTAACCGCAACTCAGCTCGTGGGTTTGAAGTCATTGACGAAATCAAAGCTGCATTAGAGGAGGCGTG
CCCCCAAACCGTCTCGTGTGCTGATATTATGGCTCTGGCAGCTCGAGACTCCACCGTTCTG
GTACTATATCTATCCTAACACAACCATGGTCCATGGCACATTACAACTTATTTGAACCT
TAAATCATGAATGCATGTTTTAAATTTGTGCAGACTGGTGGACCAAGTTGGGAAGTCCCATTGGGTAGAAGAGATTCATTAGGTGCAAGCTTGAGTGGTTCTAACCAAAATATTCCTGCT
CCAAACAACACCTTACAGACCATTCTTACCAAATTTAAGCTCAAGGGTCTTGACATTGTTGATTTTGTAGCACTTTCTG
GTATGATTTAAACATGGTTTCCTGGAAAAAAAAAAAAGGTT
AATATTTGGCCATTTGGGAATATCACAAAAAATAATCTAATCTTTTACTTTTATTTTTACTAAATTAATGATTGACCAAATAACGTTGCGCTGACGTGGTGCAAGAATCCCATAACCTTG
CACTAACGTGGCACAACATTGGCCTTCTCTTGCGTTAAAGTAGAACAAGCTTTTATTTTTCTCTTTTTCTTTTAAATTAAATCAAGTTCGAATGATTTTAGATTTTATTTACTAAAAAGT
TTATAATAATGTTAATATTTTAGAAGTAAAAAGGTTATAATAATATTAATATTTTAATTTTTTTTTTTTTCTGGCGCAAGGAGGACATGTGTTGGTTGGTTGTTTAGTGGAGGCCGGAAA
TCCTTAGAAAGTTAAAAAGTCAGTGACATGTTAATATGATTTTCTTATGAAATGACTATTCTTGTGATTTCCCTTAAATAGTTTGCATGCTTCGACTAATTACGAAAATGATCAAAAGTT
TTTTTTTTAACATCTTCATCATACTCATACTCAGTAAATCACATCAATAGCAAAGCTAAGATAGGGTCTAAGCAAATTTAAATGTAGATAACCTTACTTATATCGCGTAGGACTATAGAG
ACTGTTTCTAGGGATACCCCTAACTTGATAGTAGTTTTACATCAAGCCTTAGATATAAGGCATATAACACTCAACAATTAAGACAAAGACCGACTAGTGCATGTACTCCATTGTCTTTCG
GCTATCAATGCCACCACATGAATCATGATTAAGCATCCTCTATTTTAACGTTATTTTCACGAAATTAGTAAAATAACGTTAAAATTAGCGCACTTTCACTTTTGCCCCCCAAACACCCAC
ACATGTATAGATTATATGCGCATAACGCAAGCGGGGCGTAAAAGTTTTCTTTAACATGATTGATTGAAAAGAAGAAGCAAGTATCTTTTACATGAAAATCTTAGAATACCCTATAATTCA
AACAAATCTTGAAATATTCAAGAAAACATGAATCAAGAAAATCTTGAAAGCTCTATTATAATATAGTTGAATAAAAATGAAGATCTCTTTGGGCTTAAACTTTTCACTTTGCAGGAAGTC
ACACTATCGGAAATGCTAGGTGTACAAGTTTCAGGCAAAGGCTATACAACAACATGGGTATGGTGCATCCCGACTTCTCGCTAGACCAATCATATGACGTGGAGCTTCGCCAAAACTGCC
CAAGATCCGGCGGCGATCAGAACCTATTTGTCCTAGATCCGGTGTCACCCACAAAGTTCGATAACGGTTATTACAAGAACTTAATTGCTAAAAGGGGTCTTCTAAGCTCTGATGAAATAC
TTTTTACTCAAAGCCAACAAACAATGGAGTTTGTGAAGCAGTATGCTGAAAATCAAGAGCTTTTCTTCCAGCAGTTTGCAAAGTCTATGGTTAAAATGGGAAACATTACTCCGTTGACTG
GTGAATGTGGTCAAATCAGAAAGACTTGCAGGAAAGTCAACGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGGTCGTCAATCACCATGCTCATGGTTCTAATCTCTATCTTGACTCTAGCCAATGGCTCTTACCTCTACCCTCAGTTTTATGACATCTCATGTCCGCAAGCTAAACACATCGTC
AGGTGTGTCGTCGAAAAAGCTGTTGCAAAAGAGGCTCGTATGGCTGCTTCTTTGCTCAGGCTCCATTTCCACGATTGTTTTGTCAAG
GGGTGCGATGCTTCGATACTTCTTGACAACAGT
GGAACCATAGTCAGCGAGAAGGGATCCGTCCCTAACCGCAACTCAGCTCGTGGGTTTGAAGTCATTGACGAAATCAAAGCTGCATTAGAGGAGGCGTGCCCCCAAACCGTCTCGTGTGCT
GATATTATGGCTCTGGCAGCTCGAGACTCCACCGTTCTG
ACTGGTGGACCAAGTTGGGAAGTCCCATTGGGTAGAAGAGATTCATTAGGTGCAAGCTTGAGTGGTTCTAACCAAAATATT
CCTGCTCCAAACAACACCTTACAGACCATTCTTACCAAATTTAAGCTCAAGGGTCTTGACATTGTTGATTTTGTAGCACTTTCTG
GAAGTCACACTATCGGAAATGCTAGGTGTACAAGT
TTCAGGCAAAGGCTATACAACAACATGGGTATGGTGCATCCCGACTTCTCGCTAGACCAATCATATGACGTGGAGCTTCGCCAAAACTGCCCAAGATCCGGCGGCGATCAGAACCTATTT
GTCCTAGATCCGGTGTCACCCACAAAGTTCGATAACGGTTATTACAAGAACTTAATTGCTAAAAGGGGTCTTCTAAGCTCTGATGAAATACTTTTTACTCAAAGCCAACAAACAATGGAG
TTTGTGAAGCAGTATGCTGAAAATCAAGAGCTTTTCTTCCAGCAGTTTGCAAAGTCTATGGTTAAAATGGGAAACATTACTCCGTTGACTGGTGAATGTGGTCAAATCAGAAAGACTTGC
AGGAAAGTCAACGGTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTAGCCTTTC ATTAGCCATA GTGAGCTAAC CCATCACAAT AATATGGCTC GGTCGTCAAT CACCATGCTC ATGGTTCTAA TCTCTATCTT GACTCTAGCC AATGGCTCTT ACCTCTACCC  TCAGTTTTAT GACATCTCAT GTCCGCAAGC TAAACACATC GTCAGGTGTG TCGTCGAAAA AGCTGTTGCA AAAGAGGCTC GTATGGCTGC TTCTTTGCTC AGGCTCCATT TCCACGATTG  TTTTGTCAAG GGGTGCGATG CTTCGATACT TCTTGACAAC AGTGGAACCA TAGTCAGCGA GAAGGGATCC GTCCCTAACC GCAACTCAGC TCGTGGGTTT GAAGTCATTG ACGAAATCAA  AGCTGCATTA GAGGAGGCGT GCCCCCAAAC CGTCTCGTGT GCTGATATTA TGGCTCTGGC AGCTCGAGAC TCCACCGTTC TGACTGGTGG ACCAAGTTGG GAAGTCCCAT TGGGTAGAAG  AGATTCATTA GGTGCAAGCT TGAGTGGTTC TAACCAAAAT ATTCCTGCTC CAAACAACAC CTTACAGACC ATTCTTACCA AATTTAAGCT CAAGGGTCTT GACATTGTTG ATTTTGTAGC  ACTTTCTGGA AGTCACACTA TCGGAAATGC TAGGTGTACA AGTTTCAGGC AAAGGCTATA CAACAACATG GGTATGGTGC ATCCCGACTT CTCGCTAGAC CAATCATATG ACGTGGAGCT  TCGCCAAAAC TGCCCAAGAT CCGGCGGCGA TCAGAACCTA TTTGTCCTAG ATCCGGTGTC ACCCACAAAG TTCGATAACG GTTATTACAA GAACTTAATT GCTAAAAGGG GTCTTCTAAG  CTCTGATGAA ATACTTTTTA CTCAAAGCCA ACAAACAATG GAGTTTGTGA AGCAGTATGC TGAAAATCAA GAGCTTTTCT TCCAGCAGTT TGCAAAGTCT ATGGTTAAAA TGGGAAACAT  TACTCCGTTG ACTGGTGAAT GTGGTCAAAT CAGAAAGACT TGCAGGAAAG TCAACGGTTA AAAAAGAGGG TATTATGCTA TGCTATCATG ATCCAAATAT AGAAATAACT ATGGTTTGAC 
GTAATATGGT GCTTTTCAGT TT 

Retrieve as FASTA