Entry information : OsPrx121
Entry ID 1131
Creation 2005-07-19 (Filippo Passardi)
Last sequence changes 2005-07-19 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx121
Name OsPrx121
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Leaves
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx121
start..stop
S start..stop
OsPrx120 608 0 3..328 4..331
SiPrx158 498 2e-179 4..328 5..329
SbPrx11 496 1e-178 25..328 26..330
SbPrx09 491 1e-176 11..328 14..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9433204..9433431 228 N° 2 9433515..9434273 759  
join(9433204..9433431,9433515..9434273)


exon

Literature and cross-references OsPrx121
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6K2D3
DNA ref. GenBank:   NC_008402.1 (9433204..9434270)
Protein sequence: OsPrx121
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   34924.95 (32435.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.46 (8.30) Peptide Signal:   %s   cut: 28 range:28-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMARVATAALMVAAAVLLGLAGAGHAQLQNGFYKGKCGANDVEAVVQGIVRARFARDAPIVAYLLRMQFHECAVNGCDGGLLIDGPGTEKTASPNLSVKGYDLIADIKAELERRCPGVVSCSDIQILATRDAVVLAGGQPYAVRTGRRDRRQSRASDVVLPAPDSTAAQTVAYFGKLGLSAFDAVLLLGAHTVGATHCGVIKDSRLYRYGGRAGATDPALDPYYAFVYKTWVCPNAAASDGNVVFLDDQWSALRVDSNYYKQLQRRRGVLPCDQNLYGDGSTRWIVDLLANSDLFPSLFPQALIKLGEVNVLTGAQGEIRKVCSKFN*

Retrieve as FASTA  
Remarks chromosome 9. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGAGGGTGGCCACGGCGGCGCTAATGGTGGCGGCCGCCGTACTGCTGGGGCTCGCCGGCGCCGGCCACGCGCAGCTGCAGAACGGGTTCTACAAGGGCAAGTGCGGCGCC
AACGACGTGGAGGCCGTCGTGCAGGGCATCGTCCGTGCTCGCTTCGCCCGCGACGCCCCCATCGTCGCCTACCTCCTCCGCATGCAGTTCCACGAGTGCGCCGTCAAT
GTACCTGCCAAT
CTCTAGGTGATTGGATGATTGATATGATCGTGGCTGAAGCTGAACATCTCCATGGATCGATGATCATGCAGGGATGCGACGGCGGGCTGCTGATCGACGGGCCAGGCACGGAGAAGACGG
CGTCGCCGAACCTGAGCGTGAAGGGGTACGACCTCATCGCCGACATCAAGGCGGAGCTGGAGAGGCGGTGCCCCGGCGTGGTGTCCTGCTCCGACATCCAGATCCTCGCCACCCGCGACG
CCGTCGTGCTCGCCGGCGGGCAGCCGTACGCGGTGCGCACGGGGCGGAGGGACCGCCGCCAGTCGAGGGCCTCCGACGTGGTCCTGCCGGCGCCGGACAGCACGGCGGCGCAGACCGTCG
CCTACTTCGGCAAGCTCGGGCTGAGCGCGTTCGACGCGGTGCTCCTCCTGGGCGCGCACACCGTCGGCGCCACGCACTGCGGCGTGATCAAGGACAGCCGGCTGTACAGGTACGGCGGCC
GCGCCGGCGCGACGGACCCGGCGCTGGACCCGTACTACGCGTTCGTGTACAAGACGTGGGTGTGCCCCAACGCGGCGGCGTCCGACGGCAACGTGGTCTTCCTCGACGACCAGTGGAGCG
CGCTGCGGGTGGACAGCAACTACTACAAGCAGCTGCAGCGCCGCCGCGGCGTGCTCCCCTGCGACCAGAACCTCTACGGCGACGGCTCGACGCGGTGGATCGTCGACCTGCTCGCCAACT
CCGACCTCTTCCCGTCGCTCTTCCCGCAGGCGCTCATCAAGCTCGGCGAGGTCAACGTGCTCACCGGAGCTCAGGGAGAGATCCGCAAGGTCTGCAGCAAGTTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATGGCGAGGGTGGCCACGGCGGCGCTAATGGTGGCGGCCGCCGTACTGCTGGGGCTCGCCGGCGCCGGCCACGCGCAGCTGCAGAACGGGTTCTACAAGGGCAAGTGCGGCGCC
AACGACGTGGAGGCCGTCGTGCAGGGCATCGTCCGTGCTCGCTTCGCCCGCGACGCCCCCATCGTCGCCTACCTCCTCCGCATGCAGTTCCACGAGTGCGCCGTCAAT
GGATGCGACGGC
GGGCTGCTGATCGACGGGCCAGGCACGGAGAAGACGGCGTCGCCGAACCTGAGCGTGAAGGGGTACGACCTCATCGCCGACATCAAGGCGGAGCTGGAGAGGCGGTGCCCCGGCGTGGTG
TCCTGCTCCGACATCCAGATCCTCGCCACCCGCGACGCCGTCGTGCTCGCCGGCGGGCAGCCGTACGCGGTGCGCACGGGGCGGAGGGACCGCCGCCAGTCGAGGGCCTCCGACGTGGTC
CTGCCGGCGCCGGACAGCACGGCGGCGCAGACCGTCGCCTACTTCGGCAAGCTCGGGCTGAGCGCGTTCGACGCGGTGCTCCTCCTGGGCGCGCACACCGTCGGCGCCACGCACTGCGGC
GTGATCAAGGACAGCCGGCTGTACAGGTACGGCGGCCGCGCCGGCGCGACGGACCCGGCGCTGGACCCGTACTACGCGTTCGTGTACAAGACGTGGGTGTGCCCCAACGCGGCGGCGTCC
GACGGCAACGTGGTCTTCCTCGACGACCAGTGGAGCGCGCTGCGGGTGGACAGCAACTACTACAAGCAGCTGCAGCGCCGCCGCGGCGTGCTCCCCTGCGACCAGAACCTCTACGGCGAC
GGCTCGACGCGGTGGATCGTCGACCTGCTCGCCAACTCCGACCTCTTCCCGTCGCTCTTCCCGCAGGCGCTCATCAAGCTCGGCGAGGTCAACGTGCTCACCGGAGCTCAGGGAGAGATC
CGCAAGGTCTGCAGCAAGTTCAACTAA

Retrieve as FASTA