Entry information : OsPrx122 (LOC_Os09g29490)
Entry ID 1132
Creation 2005-07-19 (Filippo Passardi)
Last sequence changes 2005-07-19 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: OsPrx122 (LOC_Os09g29490)
Name (synonym) OsPrx122 (LOC_Os09g29490)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Pannicles
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx122
start..stop
S start..stop
BdiPrx122 556 0 31..348 23..339
TmPrx07 555 0 34..349 22..336
TaPrx15 555 0 34..349 22..336
SiPrx121 541 0 18..345 8..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17880761..17881015 255 N° 2 17880373..17880564 192 N° 3 17878271..17878906 636  
complement(join(17878271..17878906,17880373..17880564,17880761..17881015))


exon

Literature and cross-references OsPrx122 (LOC_Os09g29490)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q6K4J4
DNA ref. GenBank:   NC_008402.1 (17881015..17878274)
Protein sequence: OsPrx122 (LOC_Os09g29490)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   360 (325)
PWM (Da):   %s   38382.18 (35075.3) Transmb domain:   %s   o10-32i
PI (pH):   %s   4.9 (4.80) Peptide Signal:   %s   cut: 36 range:36-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLLLRRGGGFAAATVLAVVVVALVLSCGGGAEAAVRDLRVGYYAETCPDAEAVVRDTMARARAHEARSVASVMRLQFHDCFVNGCDGSVLMDATPTMAGEKEALSNINSLRSFDVVDEIKEALEERCPGVVSCADIIVMAARDAVALTGGPFWDVRLGREDSLTASQEDSDNIMPSPRANATTLIKLFAGYNLTVTDLVALSGSHSIGEARCFSIVFRLYNQSGSGRPDPNMDPAYRAGLDSLCPRGGDENVTGGMDATPLVFDNQYFKDLVRLRGFLNSDQTLFSDNAGTRLAVRKFGEDQGAFFRAFVEGMIKMGELQNPRKGEIRRNCRVANAPAPPPVEAEVAATSKAVVLVDF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, introns 1 and 2) and 8 ESTs. Rice blast fungus interaction, leaf library induced by M.grisea
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGAATAAAA ATTTGACAGT TTTAAAGGTT ATAAATCTGA CAGAATTTTT TTATGCTACG TGTATATTAT AAATGTGAAT ATGAGACATT ACAAACAATA CTATTAGAAG TATATGTACA  ATTTTTTATA AAAACTTTGA TAAAATTTAT TAGTCATTAT GCACGATATA TACACGAGAA GACTTGACTC GGCCTCTTAC GATAAGGTAA ATCTTACTCT GTTGTATAGC TGTGCCAAAG  CCTATGCAAC TATCTTTATC TTTGACCTAG TGTGGAAGAG TCTCACCATT GATTATGTAT TTATTCTTAT TTATTATGTT TATCTACTTT TAGCTACTTC TATCTTTTAT TCTTATATAT  CATTAAATAT TTGTGCCTTT ATTTTTCCTA ATAAAGAATG GCACTAAAAT ACTACGCCTT CTTTTTCCAA CCGGAAAAAG ACCCCAAGTC ACCATCGTTT TTTACACCGC TGCTCTCCAT  TTGCTCCCCA TGTTCCCATG ATTCCATCCC GGTTCCTGGG TCAACATGAA CAAAAATCAA AATCCACACC ACACACACCA TCGTCAATCA CACTCAACTC GCGGTCATCA CACACTACAC  AATCAGTGTC CCATAGCTAA AAGGTCCTTT TGATTATGTT TTTAGCTTAT TAACTACACG TAAAATAAAT AAACATGATT AACATATAAC TAATTAAATA CTCATTCCAT CTACTTTTGA  TAGTTATATT TCATCTTGAC ACACAGACCA AGGATAAATA AGTCTACTTA TCATCCATTT AAACATGTTA CTAGTCATTC CTCGTAACAA GCGATTCATT AATATTTACA TTTCTCGATG  CCCATGTAGG CAGTTTTGTG TGGAAGAATG GAGATTAACG CATTAAATTC GAGAAAATCA TTAAGATGAT AGGTTGTTGG ATTGAAATAT GTCTATCAAA AATAATTTTT TTAGATTTAG  AAATATGACT GTGAAAAATA GATGGAGGGA TTATTAATTA ATAAAACCCT AAAATTAGAT TTATTTGATT TTTTTAAATA TCTTCTATAT ATACTCATTC TATTTTAAAA TGTCTAACGC  CGTTAACTTT TCGTGTAGCG TTTGATCATT TGTCCAATCA AAACATATAT ATCATATATT TTGTTGTGAC ATGTTTTATC ATTAAATAAA ATATAATTTA ACTCACATTT TTACATATTT  ATACTAAAAT TTTTTAATAA GACGAATGAT CAAACATTGT ACGAAAAATT AACGGCACCA TACTTTTTCA AAAAAAGTAA TATAAAGTTT TCATAAAAAA CGCACCATTT AACGGTTTGA  AAACGCTCTC CCTAAAAACA AAGAGATAGC CAAGGCTAGT ACTCCTTCCG TTTTATAATG TAAGTCATTT TATCATTTTC CACATTCATA TTAATGTTAA TGAATCTAGA CATAACATCA  ATATAAATAT GAAAAATGCT AGAATGATTT ACATTGTGAA ACGTGAAGTA GCTGCTTAGA ACGCGCCCCA AGTCAATGCC CCCCTCCTTC CCTACTCCCT ATCACCGGAT GCACCCGTGC  TGATATTTTT GACGCACGCG CTAGTACGCT ACGGTCAGCA CCATTCACCA ACGCCGCACC CGCATGCCAG CCTGCGCCGC GCCCGGCCGT ACTCTACCCT GTACAACAGC CAAACCACCT  CGCGTCCTCC CGTCCGTCCG TGCAGTGCAC CACTGGCCGG CTGGGTTCCC CTGCACCGCG CGGCCCGTGT GTCTCCCACC CTCCCGTCTC GAGTCTCGAC TCCTCTCCCC GTCCCGACCC  GACACGTACC TCCCCTTTTC TATAACTACC CACCACCCCG CCCGGGCGCT AGTAGTACAG AGCAGAGCAC AGCAGAGGAG ATCGAGCAGA GACAGACAGA CCCGCAGGCG GAAGCGGAGG 
CAGGGCAGGC AGGCAGCAGC AACAATCCCC CACCTGCGCG TGTGCGTGTC TGTTTCGGTG CTTCCTCCTC CTCCTCGCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCCTCCTCCTCCGACGCGGCGGCGGCTTCGCTGCGGCCACGGTCCTCGCGGTCGTCGTCGTCGCGCTCGTCCTCTCCTGCGGTGGTGGCGCGGAGGCGGCCGTGAGGGACCTC
AGGGTCGGGTACTACGCCGAGACGTGCCCCGACGCCGAGGCCGTCGTCCGCGACACCATGGCCCGGGCACGCGCGCACGAGGCCCGCAGCGTCGCGTCCGTCATGCGCCTCCAGTTCCAC
GACTGCTTCGTCAAC
GTACGTCCTCGTATCGGTGATGCGATTCGAATTCTTCCGTTTCTCCTCCTCCGCCGTGCCGCGAACCGATCTGCCCTCTCGCGGTCACTCTTCGTGGGTTTCTGT
GTGTGTGTGTGTGTGTGTTTTGTTTTTGTTTGGTTTTTCTCTCCATCTGATCGGGCGATCTGCCGTGATTTGGTTCGTCGTGTTCGAGCAGGGGTGCGACGGGTCGGTGCTGATGGACGC
AACGCCGACGATGGCGGGGGAGAAGGAGGCGCTCTCCAACATCAACTCGCTCCGCTCCTTCGACGTCGTCGACGAGATCAAGGAGGCGCTGGAGGAGCGCTGCCCTGGCGTCGTCTCCTG
CGCCGACATCATCGTCATGGCCGCCCGCGACGCCGTCGCCCTG
GTACGTACACACACCCCCTCCCGCCCCGCCCCGCCGCGTCCACGCCCACTCTAGTAGTAGTACTAGTAGTACTACGT
TTCTCTTCCATTTTCCTCGCGTTTCCGTGCAAAATCCGCTGCTCCGCCTCTGCCTCTCCCCAACCCGGCATTTCCCTCCTCTCAGGAGGCACCCAGCCTCCCCCAGGCAAAAGACAAGGA
AGAAAAGTGCCAAATATCTCGATCGTTTTTTGTCATGGCTGGCTGCCCGCTGTGCGATGCAACGCCTATGCGTAACGAACAAAAAGTTAGTTCATCTCTTCGCTGCATGGTTGGTCACCC
CCAACCCAGGTGGCACAACACAGCCCTGACCTCGTTGACGAACCAACGAGCGATTGAGAATCGCCTCGCCTGGGAGTAAAATCCGGCGGTTGGCGCTCTCGTCATCGTGCGTACGGTGGC
CGTAGTCACGTGTGTGTCACATGCCGTTTCATATGAACTTGAAATTTGGATTACTCCGCATGAATTCCATTCGGAATCATCCAAAACAAAGGCGTGTGTGCGTGTGTTTGAAAATCATAG
GGACTGACGAAAATCTCCGAAAGAATCAGTGACCCGAATTGTCAAAACCATCTTTCGTTTTCCTCTCCCTTATCCTTTCATGTGCACTATAGTCCTATGCCCCTGATAGGGACGGTACAG
TGCATGTACCCGTGCTCCCTGTAACCACCACACTGAACATCAAGCGGGGGCAAGGTTGCATGAACCGTCCCCTCGGCGTGCACAAGACAAGCGCGTTTGACGTAGCCGCCGTGCAGCGAG
CCGGGAAAGGCCGGACGGTGGGGGAGCTAGGGGCCATGGCTACGTACGTGAAGCCGAACGGCCGGAGCTGCAGTTGTATAGTCCTTTTTAGACTTTTCCGTGCAGGCGATCGTGTACTGT
GTCGGGGTGCTGTCAAAACTTGTCCTTGTTGATGGCTCATCGCCGAGGGGAGGAGGAGGACCTAGGACGGAGACAAAGCAGCATTGCTTTCGCAGTGGGTCACGCTGCCGATTTGTCACT
ATGCTAGATTGCTAGCTAGCCATGTTCTTTTTGAGTTTTACACTTTTCACGCGGTTGACATGGAGCCGAGTATGATTTATCCTTCCGTTGCATTTTCATTTTCTGACATTTGATAACGTA
AACAGCGGCTCTTAACTGTACTAGTAACTGAACTGTTCTGTCATGAGTGGGCCGTACTAATTTGGATGTAAGCAAAACACATAATGCTCTTATTGTCATTACGATCTTGGGTTGAATTTG
CTGTTTTGCATGCAAATGTACAAATGTAGATACAAATAAATGATCATACGTTGCAATCAATATCCATGTCTGCACAATGCTGTAACATTGGAAGATTTGGGTTGTTAATTTCCAGGTTCG
TTTGGCTGGTCAGTGAAATTATTGACTTGATTTGACTCTCTCTCCTCCTTTCTTGTGTCTGTATCACAGACAGGTGGGCCCTTCTGGGACGTGAGGCTTGGGCGCGAGGACAGCCTGACG
GCGAGCCAGGAGGACTCGGACAACATCATGCCGAGCCCACGCGCCAACGCCACCACCCTCATCAAGCTCTTCGCCGGCTACAACCTCACCGTCACCGACCTCGTCGCGCTCTCCGGCTCG
CACTCCATCGGCGAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGGCTCCGGCAGGCCCGACCCCAACATGGACCCCGCCTACCGCGCGGGGCTCGACTCGCTCTGC
CCCCGCGGCGGCGACGAGAACGTCACCGGAGGCATGGACGCCACCCCGCTCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCGCCTCCGCGGCTTCCTCAACTCCGACCAGACGCTC
TTCTCCGACAACGCCGGGACCCGGCTCGCCGTGAGGAAATTCGGCGAGGACCAGGGCGCCTTCTTCAGGGCCTTCGTCGAAGGGATGATCAAGATGGGGGAGCTGCAGAACCCCAGGAAG
GGAGAGATACGACGCAACTGCCGTGTCGCCAATGCCCCGGCGCCGCCGCCTGTGGAGGCGGAGGTGGCGGCGACGTCCAAGGCGGTGGTCCTGGTGGACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCCTCCTCCTCCGACGCGGCGGCGGCTTCGCTGCGGCCACGGTCCTCGCGGTCGTCGTCGTCGCGCTCGTCCTCTCCTGCGGTGGTGGCGCGGAGGCGGCCGTGAGGGACCTC
AGGGTCGGGTACTACGCCGAGACGTGCCCCGACGCCGAGGCCGTCGTCCGCGACACCATGGCCCGGGCACGCGCGCACGAGGCCCGCAGCGTCGCGTCCGTCATGCGCCTCCAGTTCCAC
GACTGCTTCGTCAAC
GGGTGCGACGGGTCGGTGCTGATGGACGCAACGCCGACGATGGCGGGGGAGAAGGAGGCGCTCTCCAACATCAACTCGCTCCGCTCCTTCGACGTCGTCGACGAG
ATCAAGGAGGCGCTGGAGGAGCGCTGCCCTGGCGTCGTCTCCTGCGCCGACATCATCGTCATGGCCGCCCGCGACGCCGTCGCCCTG
ACAGGTGGGCCCTTCTGGGACGTGAGGCTTGGG
CGCGAGGACAGCCTGACGGCGAGCCAGGAGGACTCGGACAACATCATGCCGAGCCCACGCGCCAACGCCACCACCCTCATCAAGCTCTTCGCCGGCTACAACCTCACCGTCACCGACCTC
GTCGCGCTCTCCGGCTCGCACTCCATCGGCGAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGGCTCCGGCAGGCCCGACCCCAACATGGACCCCGCCTACCGCGCG
GGGCTCGACTCGCTCTGCCCCCGCGGCGGCGACGAGAACGTCACCGGAGGCATGGACGCCACCCCGCTCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCGCCTCCGCGGCTTCCTC
AACTCCGACCAGACGCTCTTCTCCGACAACGCCGGGACCCGGCTCGCCGTGAGGAAATTCGGCGAGGACCAGGGCGCCTTCTTCAGGGCCTTCGTCGAAGGGATGATCAAGATGGGGGAG
CTGCAGAACCCCAGGAAGGGAGAGATACGACGCAACTGCCGTGTCGCCAATGCCCCGGCGCCGCCGCCTGTGGAGGCGGAGGTGGCGGCGACGTCCAAGGCGGTGGTCCTGGTGGACTTC
TGA

Retrieve as FASTA