Entry information : OsPrx124
Entry ID 1134
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2014-01-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-28 (Christophe Dunand)
Peroxidase information: OsPrx124
Name OsPrx124
Class Class III peroxidase    [Orthogroup: Prx054]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx124
start..stop
S start..stop
BdiPrx116 429 2e-152 41..327 33..317
SiPrx101 416 3e-147 6..328 2..314
SbPrx120 415 6e-147 42..330 35..320
ZmPrx135 416 6e-147 41..328 42..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 468003..468483 481 N° 2 461695..462215 521  
complement(join(461695..462215,468003..468483))


exon

Literature and cross-references OsPrx124
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004).
Protein ref. UniProtKB:   Q5U1G9
DNA ref. GenBank:   NC_008403.1 (468480..461695)
Protein sequence: OsPrx124
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (301)
PWM (Da):   %s   34767.25 (31978.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.76 (4.67) Peptide Signal:   %s   cut: 30 range:30-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPASSTSSLLLVLVILLAAALISHSSANAWPASSSGSGGGGGGLSAGFYDETCPSAQDVVRRVIQDARVADPRIPASLIRLHFHDCFVNGCDASILLDEDLPSGIHTEKRVPANDNSARGFDVVDDIKCELDKACPGVVSCADILAIAAQVSVDLVGVIAGGPRWRVQLGRRDATATNIPSADNLPGFTDTLEDLVAKFDAVGLDHGDLVALQGAHTFGRAQCLFTRENCTAGQPDDALENLDPVTPDVFDNNYYGSLLRGTAKLPSDQVMLSDDPYAAATTAPFVRRFAGSQKSFFRSFAASMIKMGNISPLTGMDGQIRQNCRRINTYY

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 2). No EST found. No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCACCAGCTTCCTCCACCTCGTCTCTTCTCCTAGTGTTGGTGATACTGCTCGCAGCAGCGCTGATCAGCCACTCATCAGCCAATGCCTGGCCTGCTAGTAGCTCCGGCTCCGGC
GGCGGCGGCGGCGGCCTCAGCGCCGGATTCTACGACGAGACGTGCCCCAGCGCGCAGGACGTGGTGCGGCGCGTGATCCAGGACGCCCGCGTCGCCGACCCGCGCATCCCGGCCTCCCTC
ATCCGCCTCCACTTCCACGACTGCTTCGTCAACGGCTGCGACGCCTCCATCCTCCTCGACGAGGACCTGCCGTCCGGGATCCACACCGAGAAGCGCGTCCCGGCCAACGACAACTCCGCC
CGGGGGTTCGACGTCGTCGACGACATCAAGTGCGAGCTCGACAAGGCATGCCCGGGCGTCGTCTCCTGCGCCGACATCCTCGCCATCGCCGCCCAGGTCTCCGTCGACCTTGTTGGAGTT
A
ATTTATTTATAGAACATACCAGCCTACTCTCTAACTCTCTCTACTACTCATGAAACAAAAGTCAAGGAGCAAGTCCTTCCTCTGCGAAATTTCTAGAGTAGTGTAGACAATAATATGTT
CTTGGGCCAATTCCCTATATGCCCATGTAATTTCACCCAATCCCTTCTACGCCCCTGAAATTTGTTTGATCTCTTATATACCCCTGAGTTTTTATTTGGATCCCTTACATACCCATTCCG
TTAGTTGACCATTAGTTTGACCGTTAGTTATTGTAGAAATTACTTTATTGTCCTTGTTATATTGTTAAAAGCTAGAAATGTTTTATGTGTAAATTATTTGAGTTGTGAAAACCAATAAGG
AATAAATTACTAAATATTTGTTATGAATTTTTGAAAATAAAACATTATTTCATTAAAATAAAAAAAGATTTATTGTAAAAAAAAGTTCTGCATAAGATTTGAAAATTACTTTTCAACAAA
TATTTAGTGAAAAAAGATTCGTTGTGAAAAAACAAAGGGGATATAATTAGTTTATCACAAATTAGAAAACAAATTTAAAATTTTTAAATAAATTTCAGATCAAATTTGATGAATTTCGTA
TATCTTCCCAAAAATTTAAACCTAAATAACATTTAGTTTTTGCTCTTAATTTTCTGGTGAAACTAATGTATGGATTTAATCATAATTTTTAAAAAATAAAAAATAATAAGTTTTATTTTT
TAAGTTGGGCATTAAATGATTATATTGCTTGTATTTTGTATAAGTTTATTTTTCATATGAAAATTTATTGGGTAGGTACCACACATATGTATAGGATGGGTAGTATAGTCATTTTAAAAT
ATTTAACGGTCAACTAATGGTCAACTAACGGAGATGGGTATAGAGGAGATCAAAATGAAAACTCAGGGGTATATAAGGGATAATGTCAAATTCAGGGGTATTGAAGGGATTGAGTAAATT
TTCAGGGGTATATAGGGAATTTTCTCTATGTTCTTTGTGAGTTCTAGTATTTTCATGCATGTACCAGTACTAGTTGTGTTCAGAAAAGTTCCTAGCCATCCTATAAATAGGCAGCTATGT
CCTAGATGTGATGCTGTTGTCCAACAATCAATGTAACGTGCAATACTTGAGCAAAGCATAACCAGTTTGTGAAACAAACACAGAGCTTCTCTCCTCTGTTCTCCTTCTCTGTTCCATTGC
TAGCAAAATAATCAACAACAACAACTGGTATCAGAGCGCCCAGGTTCGAGTAGGGCGTGACGGAGTAGCACGGCGTATCGGTATTGTCAATTGAAGCTACAAGTATGGCTTCAAGTTCGG
GCGCCACAATGGCGCAGTCTATGGTTCCTGTATTTGCAGGAGAAAATTATGATATATGGAGCATCAAGATGCGGACGCTGCTGCTATCTCAAGGATTGTGGGATATTGTTGAGAATGGCT
ATCAAGAGTATTCCGCTGGAGAAACTCTTACGGCGGAACAGAAAAAGTCTTTGGCAGAGGATCGGATGTCGGACGCCAAGGCCTTGTTCTTGATCCAACAAGGAGTTGCGGAAAGTCTAT
TTCCGCGTATTATTGGCGCCAAGAAATCCAAGGAAGCATGGGACAAGTTGAAGGAGGAGTTTCAAGGATCTCAGAAGGTACTTGCGGTGAAGCTTCAAACCTTGAGAAGACAATTTCAGA
ATTTGCTAATGAAGGAGTCAGAGAAGGTAAAAGACTATTTCCCAAGAGTTATTGAGATCGTTAATCAGATGCGCCTCTATGGTGAAGATATAAACGACCAGAAGGTTGTGGAGAAAATTT
TAATCAGTCTGCCTGAAAAATACGAGTACATTGTTGCTGCTATTGAGGAGTCGAAAGACTTGTCGACTCTCACAATTCAGCAACTAATGAGCTCGTTGGAATCTCACGAAGAAAGAAAGC
TTCAGCGCGAAGGGAGCTCTATTGAAAATGCATTTCAGTCAAAGTTGAGCTTCAGGCCTCAAAACTCAAGGTTTCGAGGAAATTTTCAAAAAAATGAATTTCCAATGCGAGACCGTGGTT
ATTTTCAGAAAAATGGCTTTTCCAGGCAGAAGGAAGATGGTCAAGAGAGAAGAGAAAAAGGTACGTCCAGTTCAAATTTGTGGTGTGACATTTGCCAAAAATCTAGTCATACTACAGATA
TGTGCTGGAAGAAAATGACCTGCAACAAGTGCAAAAGAAAGGGCCATATTGCAAAATATTGCAGAACTAGAGAAATTAATCGGGCTAATTTTTCACAAGAAAAGGAAAAAATCTGAAGAA
ATGGTTTTCTCTTGCCATACTGCTCAAGAAGAAAAAGATGATGTTTGGGTTATTGACAGTGGTTGTACAAACCATATGGCCGCTGATCCAAATTTATTTCGAGAAATGGATTCATCGTAT
CATGCAAAGATCCACATGGGAAATGGCTCTATAGCCCAAAGTGAAGGCAAAGGTACGGTTGCTGTTCAAACAGCAGACGGTCCAAAATTTATAAAAGATGTTTTGTTGGTACCCGATTTA
AAGCAAAATTTGCTAAGTATTGGGCAGCTTCTAGAACACGGGTACGCGGTTTATTTTGAAGATTTTTCTTGCAAAATATTGGACCGTAAAAATAATCGTCTGGTTGCCAAAATAAATATG
GAGAAGAACAGAAATTTTCTATTAAGGATGAATCATCCAACTCAAATGGCTCTCAGGAGTGAAATTGATATTTCCGATTTATGGCACAAAAGAATGGGTCATCTTAATTACAGAGCATTG
AAGCTACTCAGGACAAAAGGTATGGTTCAAGGCCTTCCATTTATTACTCTCAAGTCTGACCCATGTGAAGGATGTGTATTTGGAAAACAAATTCGGGCTTCTTTTCCCCACAGTGGAGCT
TGGAGAGCAAGTGCACCATTGGAACTAGTGCACACTGATATAGTTGGTAAAGTGCCAACAATTTCAGAAGGAGGAAATTGGTACTTTATCACATTTATCGATGATTATACAAGAATGATC
TGGGTATATTTTCTAAAAGAAAAATCTGCAGCCTTGGAGATATTCAAAAAATTCAAGGCCATGGTGGAAAATCAGAGTAATCGAAAAATTAAAGTATTGCGCAGCGATCAAGGAGGAGAA
TATATCTCAAAAGAATTTGAGAAATATTGTGAAAATGCTGGCATCCGAAGACAGCTAACGGCAGGCTATAGTGCTCAACAAAATGGAGTTGCAGAACGGAAAAATCGGACGATCAATGAT
ATGGCCAATTCTATGCTCCAAGACAAAGGTATGCCTAAATCTTTCTGGGCTGAAGCAGTTAATACTGCAATTTATATTTTAAATAGAAGTCCTACCAAGGCAGTACCAAACCGTACACCT
TTTGAAGCTTGGTATGGTAAAAAGCCTGTCATTGGTCATATGAGAGTATTTGGTTGCATTTGCTATGCTCAAGTGCCAGCACAAAAGAGAGTAAAATTTGATAATAAAAGTGATTGGTGC
ATATTTGTTGGCTATGCTGATGGTATCAAAGGCTATAGACTTTATAATTTGGAGAAAAAGAAAATTATCATTAGCAGAGATGTGATTTTTGATGAGAGTGCTACATGGAACTGGAAGTCT
CCAGAAGCCTCTAGTACTCCATTATTGCCAACCACTACCATCACACTAGGCCAACCACATATGCATGGCACTCATGGAGTGGAAGATCATACTTCAAGTCCACAGTCATCAAGTCCAATG
TCAAGCTCAAGTGCTAGTTCAGATTCAAGCCCGAGCAGTGAAGAGCAAATTTCTACACCGGAATCAGCTCCAAGACGGGTAAGAAGTATGGTTGAATTATTAGAATCTACTTCTCAACAA
AGAGGGTCAGAACAACATGAATTTTGCAATTATTCAGTTGTTGAGCCACAAAGTTTCCAAGAAGCAGAAAAACATGATAATTGGATAAAGGCCATGGAAGATGAGATTCATATGATTGAG
AAAAATAATACATGGGAGTTGGTTGATCGTCCTAGAGACAGAAAAGTTATTGGAGTTAAGTGGGTTTATAAGACAAAATTAAATCCAGATGGCTCAGTTCAGAAATACAAGGCAAGACTT
GTGGCAAAAGGCTTTAAGCAAAAGCCTGGGATTGATTATTATGAGACATATGCTCCTGTTGCCAGGCTAGAGACAATTCGTACCATAATTGCTCTAGCAGCTCAAAAGAGGTGGAAGATT
TATCAACTTGATGTTAAATCGGCTTTCTTAAATGGCTATCTTGATGAAGAAATCTATGTTGAACAACCTGAAGGGTTTTCAGTCCAAGGGGGAGAAAATAAGGTATTCAGACTCAAGAAG
GCTTTATATGGATTAAAGCAAGCGCCTAGAGCGTGGTATAGTCAAATTGACCAGTACTTTATTCAGAAAGGATTTGCCAAGAGCATAAGTGAGCCTACTCTATATGTCAACAAAACAGGT
ACGGATATCCTAATCGTCTCACTCTATGTTGACGATTTGATATATACTGCCAATAGTGAGAAGATGATGCAAGACTTTAAAAAAGATATGATGCATACATATGAAATGAGTGATCTGGGC
TTGCTCCACTATTTTCTCGGTATGGAAGTGCATCAAAGTGATGAAGGAATATTTATATCACAAAGGAAATATGCTGAAAATATTCTAAAGAAATTTAAGATGGATAACTACAAGTCAGTT
ACAACCCCCTTGTTGCCAAATGAAAAGCAAAAGGCTAGAGATGGAGCTGATAAGGCAGATCCAACAATTTACAGAAGCTTAGTTGGAAGTTTATTATATTTGACCGCAACACGACCGGAT
ATTATGTTTGCGGCAAGTTTATTATCAAGATATATGTCTAGCCCAAGTCAATTAAATTTTACCGCTGCAAAGAGAGTTTTGCGGTATATCAAAGGGACCGCAGATTATGGTATATGGTAT
AAGCCAGTTAAAGAATCAAAATTAATTGGCTATACGGACAGTGACTGGGCTGGATGTCTTGACGATATGAAGAGCACATCAGGCTACGCTTTCTCACTTGGTTCAGGTATGTGCTCCTGG
TCTTAAAAAAAATAAAATATTGTCGCTTTATCTTCAGCCGAAGCAGAATATGTAGCAGCATCAAAAGCTGTTTCACAAGTTGTTTGGTTGAGGAGAATTATGGAAGATCTGGGCGAGAAG
CAATATCAGCCTACTACAATTTATTGCGACGGTAAGTCTGCAATTGCGATCAGCGAAAATCCAGTCAGTCATGACAGGACGAAACATATTGCTATCAAGTATCATTATATCCGGGAAGCA
GTTGATCGCCAGGAAGTTAAATTGGAATTTTGCCGAACTGATGAGCAGTTGGCAGATATATTTACCAAGGCTTTATCCAAAGAAAAATTTGTCCGCGACAGAGAGCTCATCGGAGTTTGC
AAGAAATAAATTAAGGGGGAGTTTGTTGGAGTTAATTTATTTCTAGAACATACCAGCCTACTCTCTAACTCTCTCTACTACTCATGAAACAAAAGTCAAGGAGCAAGTCCTTCCTCTGTG
AAATTTCTAGAGTAGTGTAGACAATAATATGTTCTTTGTGAGTTCTAGTATTTTCATGCATGTACCAGTACTAGTTGTGTTCAGAAAAGTTCCTAGCCATCCTATAAATAGGCAGCTATG
TCCTAGATGTGATGCTGCTGTCCAACAATCAATGTAACGTGCAATACTTGAGCAAAGCATAACCAGTTTGTGAAACAAACACAGAGCTTCTCTCCTCTGTTCTCCTTCTCTGTTCCATTG
CTAGCAAAATAATCAACAACAACAGACCTCGCCGGCGGCCCGCGCTGGCGCGTCCAGCTCGGCCGCCGCGACGCCACCGCCACCAACATCCCCAGCGCCGACAACCTCCCCGGCTTCACC
GACACGCTCGAGGACCTCGTCGCCAAGTTCGACGCCGTCGGCCTCGACCACGGCGACCTCGTGGCGCTCCAGGGCGCCCACACGTTCGGGCGGGCGCAGTGCCTGTTCACGCGGGAGAAC
TGCACGGCGGGGCAGCCGGACGACGCGCTGGAGAACCTGGACCCGGTCACCCCCGACGTGTTCGACAACAACTACTACGGCAGCCTCCTCCGCGGCACCGCCAAGCTCCCCTCCGACCAG
GTCATGCTCTCTGACGACCCCTACGCCGCCGCCACCACCGCGCCCTTCGTCCGCCGCTTCGCTGGCAGCCAGAAGAGCTTCTTCAGGAGCTTCGCGGCGTCGATGATCAAGATGGGGAAC
ATCAGCCCGCTCACCGGGATGGACGGACAGATCAGGCAAAACTGCCGCAGGATCAACACCTATTACTAG

Retrieve as FASTA