Entry information : EgrPrx192
Entry ID 11353
Creation 2012-10-23 (Qiang Li)
Last sequence changes 2016-03-13 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-13 (Achraf Jemmat)
Peroxidase information: EgrPrx192
Name EgrPrx192
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx192
start..stop
S start..stop
EcamPrx192 712 0 1..346 1..346
EglPrx192 712 0 1..346 1..346
EguPrx192 705 0 1..346 1..346
TsPrx09 535 0 2..346 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55..324 270 N° 2 603..794 192 N° 3 1034..1199 166 N° 4 1386..1798 413
join(55..324,603..794,1034..1199,1386..1798)


exon

Literature and cross-references EgrPrx192
Literature Sequenced by peroxibase team.
DNA ref. GenBank:   NW_010092443.1 (24281321..24283064)
Cluster/Prediction ref. Genebank:   104448988
Protein sequence: EgrPrx192
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (322)
PWM (Da):   %s   36974.69 (34569.4)  
PI (pH):   %s   5.66 (5.96) Peptide Signal:   %s   cut: 25 range:25-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVALSEVVFALVASAFLLSTPSTAHPGLGFGWGGGSSGSGGGHGLFPEYYLYSCPQVNDIVVSVLEQAIEREPRMAASLLRLHFHDCFVQGCDASVLLDDSATIASEKRSLPNANSLRGFEVIDEIKAKLEEVCPGVVSCADIVALAARGSTVLSGGPDWELPLGRGDSRTASLTGSNNNIPPPNSTIQNLITLFQRQGLNEADLVALSGGHTIGVARCTSFKQRLYNQNGNNQPDATLERTYYQDLKTVCPQSGGDNNISPLDIASPVKFDNSYFKLILWGKGLLNSDEVLLTGKVGKTMNLVKAYAEDESLFLQQFAKSMIKMGNISPLIGFNGEVRKNCRHVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Not initialy sequenced by E.grandis sequencing project. Sequenced by Group EEP. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCTCCGAAGTAGTCTTTGCTCTTGTGGCCTCGGCTTTCCTGTTGTCCACACCTTCCACAGCTCACCCGGGCCTTGGCTTTGGTTGGGGTGGGGGCTCCAGCGGAAGTGGC
GGGGGTCATGGCCTGTTTCCCGAATACTATCTTTACTCGTGCCCTCAAGTGAACGACATTGTTGTTTCGGTGCTGGAGCAAGCCATCGAAAGGGAACCGAGGATGGCAGCTTCCTTGCTC
CGGCTTCATTTCCACGACTGCTTTGTGCAG
GTTTGATTTTCACAAGTTTGTCAACCGGTTTTATGATTGCTTCAGAACTCGCGAAAAATATATTCACAACGGCAAGAAAGGTATCAAAGG
GGATTGATGCAAAATGACAAGAGCTAAGAAAACTAACAGTAGTCGGGTGTTTTCCCTCTTCCAATGCAAGTCAGAGAGACTAAAGCATATGCCTACGTTACCTAAAGAAATGTCGGGTTG
GATCCATTAGAGCTGCTTAGTGCCTGCAATGTAGGAGTAGCCGTTGCTTAACAAGCTATTTGTTGTAGGGATGTGATGCATCAGTTCTGCTGGACGATAGTGCGACCATAGCCAGCGAGA
AGAGGTCGCTGCCTAATGCAAACTCCCTCAGGGGGTTTGAAGTGATAGATGAAATCAAGGCCAAGTTGGAAGAAGTGTGCCCTGGTGTCGTGTCTTGTGCAGATATTGTCGCCCTTGCAG
CGCGTGGATCTACCGTTCTG
GTACGTTAGATACTCCTTTTGTATTCCTCACTCTTGTTGAATGCTTAAATGTCAAGATCAAAACCGTGAGTCACTTCCACATAAAATCCCCAGTTTAGAC
TTACCAAAGGTGTCCATATTCGAACATGTAAGACCGCCAAGACCATCAGAAAGTGACATTTCTTCTGTAGTTTTACTTCCTTAGATTGACTAACAATTTAGCTTCATTTTTTTTTTTTTT
TTCGGTTGAGATTTAACAGAGCGGTGGACCAGATTGGGAGCTTCCTCTTGGAAGGGGGGACTCTAGAACAGCAAGTCTTACGGGCTCTAATAACAATATCCCCCCTCCAAACTCCACAAT
CCAAAATCTCATCACACTCTTCCAGCGCCAAGGCCTAAATGAAGCCGATCTCGTCGCTCTCTCAG
GTACCACCCATTATTCAGCACTGAAAAATCATTAGGTGGGCTCTCTGTGTCACCA
ATTTTCTAAATTAATGTTGATTACAGCAAGGCAAAAACATGAAAACTGATTTCTGTTACTGATTTCTTTCCTTTTCATAATAAGATTCTGTCGGTGTAACATATTGCGAATTTTATCGTC
GGTATCTGCAGGAGGGCACACGATTGGGGTGGCGAGGTGTACAAGCTTCAAGCAGAGGCTGTACAACCAGAATGGGAACAACCAACCCGATGCGACTCTTGAGAGGACCTACTACCAGGA
TCTGAAAACAGTTTGCCCTCAGTCGGGTGGTGACAACAATATCTCTCCCCTGGACATTGCTTCCCCGGTCAAGTTTGACAACTCCTACTTCAAGCTTATATTATGGGGCAAAGGCCTTCT
CAATTCAGATGAAGTGCTCTTAACCGGAAAAGTGGGGAAGACTATGAATCTGGTCAAAGCCTATGCAGAAGACGAGAGCCTCTTCCTCCAGCAGTTTGCCAAGTCCATGATCAAGATGGG
TAACATCAGTCCTCTCATTGGGTTTAATGGCGAAGTGAGAAAGAATTGTCGCCATGTTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCTCCGAAGTAGTCTTTGCTCTTGTGGCCTCGGCTTTCCTGTTGTCCACACCTTCCACAGCTCACCCGGGCCTTGGCTTTGGTTGGGGTGGGGGCTCCAGCGGAAGTGGC
GGGGGTCATGGCCTGTTTCCCGAATACTATCTTTACTCGTGCCCTCAAGTGAACGACATTGTTGTTTCGGTGCTGGAGCAAGCCATCGAAAGGGAACCGAGGATGGCAGCTTCCTTGCTC
CGGCTTCATTTCCACGACTGCTTTGTGCAG
GGATGTGATGCATCAGTTCTGCTGGACGATAGTGCGACCATAGCCAGCGAGAAGAGGTCGCTGCCTAATGCAAACTCCCTCAGGGGGTTT
GAAGTGATAGATGAAATCAAGGCCAAGTTGGAAGAAGTGTGCCCTGGTGTCGTGTCTTGTGCAGATATTGTCGCCCTTGCAGCGCGTGGATCTACCGTTCTG
AGCGGTGGACCAGATTGG
GAGCTTCCTCTTGGAAGGGGGGACTCTAGAACAGCAAGTCTTACGGGCTCTAATAACAATATCCCCCCTCCAAACTCCACAATCCAAAATCTCATCACACTCTTCCAGCGCCAAGGCCTA
AATGAAGCCGATCTCGTCGCTCTCTCAG
GAGGGCACACGATTGGGGTGGCGAGGTGTACAAGCTTCAAGCAGAGGCTGTACAACCAGAATGGGAACAACCAACCCGATGCGACTCTTGAG
AGGACCTACTACCAGGATCTGAAAACAGTTTGCCCTCAGTCGGGTGGTGACAACAATATCTCTCCCCTGGACATTGCTTCCCCGGTCAAGTTTGACAACTCCTACTTCAAGCTTATATTA
TGGGGCAAAGGCCTTCTCAATTCAGATGAAGTGCTCTTAACCGGAAAAGTGGGGAAGACTATGAATCTGGTCAAAGCCTATGCAGAAGACGAGAGCCTCTTCCTCCAGCAGTTTGCCAAG
TCCATGATCAAGATGGGTAACATCAGTCCTCTCATTGGGTTTAATGGCGAAGTGAGAAAGAATTGTCGCCATGTTAATTAG

Retrieve as FASTA