Entry information : ChigAPx-CcP01 (ChigHyBpox1)
Entry ID 11362
Creation 2012-11-21 (Marcel Zamocky)
Last sequence changes 2013-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2017-03-06 (Marcel Zamocky)
Peroxidase information: ChigAPx-CcP01 (ChigHyBpox1)
Name (synonym) ChigAPx-CcP01 (ChigHyBpox1)
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Glomerellaceae Colletotrichum
Organism Colletotrichum higginsianum    [TaxId: 80884 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ChigAPx-CcP01
start..stop
S start..stop
CfioAPx-CcP01_PJ7 928 0 1..538 1..536
CfioAPx-CcP01_MH18 928 0 1..538 1..536
CorbiAPx-CcP1 918 0 1..538 1..539
CgloAPx-CcP03_Naragc5 912 0 1..538 1..539
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3298..3433 136 N° 2 3138..3220 83 N° 3 1672..3069 1398  
complement(join(1672..3069,3138..3220,3298..3433)


exon

Literature and cross-references ChigAPx-CcP01 (ChigHyBpox1)
Protein ref. UniProtKB:   H1UY12
DNA ref. GenBank:   CACQ02000564.1 (3433..1672)
Protein sequence: ChigAPx-CcP01 (ChigHyBpox1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   538 (521)
PWM (Da):   %s   57582.31 (55887.3)  
PI (pH):   %s   4.58 (4.51) Peptide Signal:   %s   cut: 23 range:18-538
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKQGILAALALASVARTEYVWPSPYDEIEDHLSLQSGYLRRGFIDGVINCGFGGNVPGRQNSAEWIRAAFHDATHDATAGTGGLDASIFFELDRPENIGAAFNNTFGFFSSFYSVRASASDLLAMSVLVASFSCGGNKMPFRAGRIDAHEAGPAGVPEPQTDLKTTQDAFTKAGFNTSDMIAMVACGHTLGGVHSVDFPEIVGVEADPNNDTIAHFDVEFSRFDHGVVTEYLDDTTKNPLVAGTNDTLNSDKRIFSADGNKTMQAMADPAAFQATCADIFTRMIDTVPATVKLTEPIVATDIKPYIGGLFLKDDGNISFTGQIRIRTSADTGRDPSDLSVQLTYADRNGNGSNAITTRKATFQGGSASGLWRESFHFWEFDGTISPDVGISKFYIHVTKTSTNETVTYDNAGNGYPMSDVVLYQKSQSCLGDPVDGKLALTVKALVRKDRAPTAAGGLTLDLVREIRRQGVIVPKLEVETIDFQSAGQDRGQWAVYTAGADLDSLGWSTTFDIKLGGDDPVEVAFQKTTGLGSNVCS*

Retrieve as FASTA  
Remarks complete from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGGGCATCCTCGCCGCGCTCGCTCTGGCATCCGTTGCCAGGACGGAGTATGTCTGGCCGTCGCCTTACGATGAGATTGAGGATCATCTCTCTCTGCAATCGGGCTACCTGCGC
AGGGGCTTCATAGATG
GTCCGTCACACCGAGCTATCTGACTGATGATGCCTCCACTGGGCGTGTACGTGTTCTATCCTGTTAACACCAAATAGGCGTCATCAACTGCGGCTTCGGCGGCA
ATGTCCCAGGCCGCCAAAACTCGGCCGAATGGATCCGCGCTGCCTTTCACGATATG
GTAAGCTAGCTTTTAACTTTCCGTGGCGCCCCAAAGTCTTGCATCTCAAAAGACTCACAATCTC
GCAGGCCACACATGATGCTACCGCCGGCACTGGCGGCCTTGACGCCTCCATCTTCTTCGAGCTGGACCGTCCCGAGAACATCGGCGCCGCCTTCAACAACACCTTTGGCTTTTTCAGCAG
CTTCTACTCCGTCCGTGCCTCTGCCTCTGACCTGCTGGCCATGAGCGTTCTCGTCGCCAGTTTCAGCTGCGGCGGCAACAAGATGCCCTTCCGAGCCGGCCGCATCGACGCCCACGAAGC
CGGTCCCGCCGGTGTCCCGGAGCCTCAGACCGACCTCAAGACCACCCAAGACGCCTTCACCAAGGCCGGGTTCAACACGAGCGACATGATCGCCATGGTCGCCTGCGGTCACACCCTGGG
TGGCGTCCACAGCGTCGACTTCCCCGAAATCGTCGGCGTCGAGGCGGACCCGAACAACGACACCATCGCGCACTTCGACGTCGAGTTTTCCCGCTTCGACCACGGCGTCGTGACCGAGTA
TTTGGACGACACGACCAAGAACCCCCTGGTGGCCGGCACCAACGACACGCTCAACTCGGACAAGCGGATCTTCTCCGCGGACGGCAACAAGACGATGCAGGCCATGGCCGATCCCGCCGC
CTTCCAGGCCACCTGTGCCGACATCTTCACCCGCATGATCGACACCGTGCCCGCCACCGTCAAACTGACCGAGCCTATCGTCGCCACCGACATCAAGCCATACATCGGGGGCCTGTTCCT
CAAAGATGACGGCAACATCTCCTTTACCGGACAGATCCGCATTCGCACGTCCGCCGACACCGGCCGGGACCCTTCCGATCTGTCCGTCCAGTTGACTTACGCGGACCGCAATGGCAACGG
CTCCAACGCCATCACCACCCGGAAGGCGACTTTCCAGGGCGGCTCGGCGTCCGGTCTCTGGCGAGAGTCGTTCCACTTCTGGGAGTTCGACGGCACCATCAGCCCCGACGTCGGCATCAG
CAAGTTCTACATCCACGTCACCAAGACGTCGACGAACGAGACCGTCACCTACGACAACGCGGGCAACGGCTACCCGATGAGCGACGTGGTCCTGTACCAGAAGTCGCAGTCCTGCCTCGG
CGACCCGGTCGACGGGAAGCTGGCGCTGACGGTCAAGGCCCTCGTCCGCAAGGACCGCGCGCCCACGGCCGCCGGCGGGCTGACGCTGGATCTCGTCCGTGAGATCCGGAGGCAGGGGGT
GATCGTCCCCAAGCTGGAAGTCGAGACCATCGACTTCCAGTCCGCCGGGCAGGACAGGGGCCAATGGGCCGTCTACACGGCCGGTGCTGACCTCGACTCGCTCGGCTGGAGCACTACGTT
TGACATCAAGTTGGGCGGAGACGACCCTGTCGAGGTTGCGTTCCAGAAGACAACCGGCTTGGGATCGAATGTGTGCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCAGGGCATCCTCGCCGCGCTCGCTCTGGCATCCGTTGCCAGGACGGAGTATGTCTGGCCGTCGCCTTACGATGAGATTGAGGATCATCTCTCTCTGCAATCGGGCTACCTGCGC
AGGGGCTTCATAGATG
GCGTCATCAACTGCGGCTTCGGCGGCAATGTCCCAGGCCGCCAAAACTCGGCCGAATGGATCCGCGCTGCCTTTCACGATATGGCCACACATGATGCTACCGCC
GGCACTGGCGGCCTTGACGCCTCCATCTTCTTCGAGCTGGACCGTCCCGAGAACATCGGCGCCGCCTTCAACAACACCTTTGGCTTTTTCAGCAGCTTCTACTCCGTCCGTGCCTCTGCC
TCTGACCTGCTGGCCATGAGCGTTCTCGTCGCCAGTTTCAGCTGCGGCGGCAACAAGATGCCCTTCCGAGCCGGCCGCATCGACGCCCACGAAGCCGGTCCCGCCGGTGTCCCGGAGCCT
CAGACCGACCTCAAGACCACCCAAGACGCCTTCACCAAGGCCGGGTTCAACACGAGCGACATGATCGCCATGGTCGCCTGCGGTCACACCCTGGGTGGCGTCCACAGCGTCGACTTCCCC
GAAATCGTCGGCGTCGAGGCGGACCCGAACAACGACACCATCGCGCACTTCGACGTCGAGTTTTCCCGCTTCGACCACGGCGTCGTGACCGAGTATTTGGACGACACGACCAAGAACCCC
CTGGTGGCCGGCACCAACGACACGCTCAACTCGGACAAGCGGATCTTCTCCGCGGACGGCAACAAGACGATGCAGGCCATGGCCGATCCCGCCGCCTTCCAGGCCACCTGTGCCGACATC
TTCACCCGCATGATCGACACCGTGCCCGCCACCGTCAAACTGACCGAGCCTATCGTCGCCACCGACATCAAGCCATACATCGGGGGCCTGTTCCTCAAAGATGACGGCAACATCTCCTTT
ACCGGACAGATCCGCATTCGCACGTCCGCCGACACCGGCCGGGACCCTTCCGATCTGTCCGTCCAGTTGACTTACGCGGACCGCAATGGCAACGGCTCCAACGCCATCACCACCCGGAAG
GCGACTTTCCAGGGCGGCTCGGCGTCCGGTCTCTGGCGAGAGTCGTTCCACTTCTGGGAGTTCGACGGCACCATCAGCCCCGACGTCGGCATCAGCAAGTTCTACATCCACGTCACCAAG
ACGTCGACGAACGAGACCGTCACCTACGACAACGCGGGCAACGGCTACCCGATGAGCGACGTGGTCCTGTACCAGAAGTCGCAGTCCTGCCTCGGCGACCCGGTCGACGGGAAGCTGGCG
CTGACGGTCAAGGCCCTCGTCCGCAAGGACCGCGCGCCCACGGCCGCCGGCGGGCTGACGCTGGATCTCGTCCGTGAGATCCGGAGGCAGGGGGTGATCGTCCCCAAGCTGGAAGTCGAG
ACCATCGACTTCCAGTCCGCCGGGCAGGACAGGGGCCAATGGGCCGTCTACACGGCCGGTGCTGACCTCGACTCGCTCGGCTGGAGCACTACGTTTGACATCAAGTTGGGCGGAGACGAC
CCTGTCGAGGTTGCGTTCCAGAAGACAACCGGCTTGGGATCGAATGTGTGCAGCTGA

Retrieve as FASTA