Entry information : McirCcP02
Entry ID 11371
Creation 2012-12-13 (Christophe Dunand)
Last sequence changes 2012-12-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-12-13 (Christophe Dunand)
Peroxidase information: McirCcP02
Name McirCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Mucoraceae Mucor
Organism Mucor circinelloides    [TaxId: 36080 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value McirCcP02
start..stop
S start..stop
RoCcP02 570 0 1..371 1..366
PblCcP01 468 2e-166 4..368 3..367
UramCcP02 468 3e-166 19..371 19..368
RoCcP01 457 6e-162 41..372 16..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3647860..3648037 178 N° 2 3648101..3648269 169 N° 3 3648335..3648441 107 N° 4 3648502..3648770 269
N° 5 3648874..3649269 396  
join(3647860..3648037,3648101..3648269,3648335..3648441,3648502..3648770,3648874 ..3649269)


exon

Literature and cross-references McirCcP02
DNA ref. JGI genome:   scaffold_03 (3647860..3649270)
Cluster/Prediction ref. JGI gene:   155851
Protein sequence: McirCcP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372
PWM (Da):   %s   41002.5  
PI (pH):   %s   8.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPLRSTLLRSTRVNPRALVASGSILGASSRIGGIRAAGMRGYSTESPKKGGSGGLVFLTLAALGAGAGYYYNSTQTIKTKTLSTPSAAGKTEKKKNIDYQQVYNDIAEMLDEDSDYDDGSYGPVLVRLAWHASGTYDKDTKTGGSNGATRFAPESKHAANNGLAIARDLMEKIHAKYPEISYGDLWTLAGVCAVQELGGPTIPWRAGREDAFETSCTPDGRLPDAGKKEDHIRDIFYRGFNDQEIVALAGAHALGRCHPDRSGFEGPWQEAPTVFSNEYFKAISTRKWVKKDLKNGGWQWVDKNNTDVMMLPAEIAMYNDKEFKKYFDLYAKDEDKFFKDFAAVFQKLLELGVPFKGDEKVYHFKRTTE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCCTCTTCGCTCTACTCTACTCAGATCTACTCGTGTCAATCCTCGTGCTTTGGTCGCTTCAGGATCTATCCTCGGTGCTTCCAGTCGCATTGGAGGTATTCGTGCTGCCGGCATG
CGTGGTTACTCTACTGAATCACCCAAGAAGGGTGGCTCTGGTGGTCTCGTCTTTTTGA
GTAAATATAGCCGTGGCAATGTGAATGATACAATTTGACCTAATCATGCATGAAACACATTA
GCATTGGCTGCACTTGGCGCTGGCGCTGGTTACTATTACAACTCGACTCAAACCATCAAGACCAAGACGCTCTCTACTCCTTCTGCTGCTGGCAAGACTGAAAAGAAAAAGAACATTGAT
TACCAACAGGTATATAACGACATTGCCGAGATGCTTGATGAAGACTCAGA
GTAAGCGTGTATTTTGCATGTGGGAAAATATACCTCGGTATTGACACTCCTATCGTTCACATTAGCTATG
ATGATGGATCCTATGGTCCTGTTTTGGTTCGTCTCGCCTGGCACGCTTCTGGCACTTATGATAAGGATACCAAGACTGGTGGTAGCAATGGTGCTACTATGC
GTACGTAGTGAGATATGG
TAACTGGTTGCTAGGAAACTGACCCACTTTTTCTATTTGCAGGTTTTGCTCCCGAGTCCAAGCACGCTGCCAACAATGGTTTAGCCATCGCTCGTGATTTGATGGAAAAGATTCATGCCA
AATACCCCGAAATCAGCTATGGTGATCTCTGGACTTTGGCTGGTGTCTGTGCTGTTCAAGAATTAGGCGGCCCTACCATCCCATGGAGAGCTGGCCGCGAAGATGCATTCGAGACTAGCT
GTACTCCCGATGGCCGTCTTCCTGATGCTGGTAAAAAAGAAGACCATATTCGCGATATTTTCTACAGAATG
GTAAGTGCTGTGCTGTGTATTTGTGTGTGTAAACACAACCTTAACAGGT
TACACAACCACCATCCAACTCTGGGATTCATGGCTAACCTGTCTGCGATGATAGGGCTTCAATGACCAAGAGATCGTTGCTTTAGCTGGTGCTCATGCTTTGGGTCGTTGCCACCCTGAC
CGCAGTGGATTTGAGGGCCCATGGCAAGAAGCCCCCACTGTCTTCTCTAACGAATATTTCAAGGCCATCTCTACTCGCAAATGGGTCAAGAAGGACTTGAAGAACGGTGGCTGGCAATGG
GTCGATAAGAACAACACCGATGTTATGATGTTGCCTGCTGAAATTGCCATGTACAACGACAAGGAATTCAAGAAATACTTTGACTTGTATGCCAAGGATGAAGACAAGTTCTTTAAGGAT
TTCGCCGCCGTATTCCAAAAGCTCCTTGAATTGGGTGTTCCCTTCAAGGGTGATGAAAAGGTGTACCACTTTAAGCGTACCACCGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCCTCTTCGCTCTACTCTACTCAGATCTACTCGTGTCAATCCTCGTGCTTTGGTCGCTTCAGGATCTATCCTCGGTGCTTCCAGTCGCATTGGAGGTATTCGTGCTGCCGGCATG
CGTGGTTACTCTACTGAATCACCCAAGAAGGGTGGCTCTGGTGGTCTCGTCTTTTTGA
CATTGGCTGCACTTGGCGCTGGCGCTGGTTACTATTACAACTCGACTCAAACCATCAAGACC
AAGACGCTCTCTACTCCTTCTGCTGCTGGCAAGACTGAAAAGAAAAAGAACATTGATTACCAACAGGTATATAACGACATTGCCGAGATGCTTGATGAAGACTCAGA
CTATGATGATGGA
TCCTATGGTCCTGTTTTGGTTCGTCTCGCCTGGCACGCTTCTGGCACTTATGATAAGGATACCAAGACTGGTGGTAGCAATGGTGCTACTATGC
GTTTTGCTCCCGAGTCCAAGCACGCT
GCCAACAATGGTTTAGCCATCGCTCGTGATTTGATGGAAAAGATTCATGCCAAATACCCCGAAATCAGCTATGGTGATCTCTGGACTTTGGCTGGTGTCTGTGCTGTTCAAGAATTAGGC
GGCCCTACCATCCCATGGAGAGCTGGCCGCGAAGATGCATTCGAGACTAGCTGTACTCCCGATGGCCGTCTTCCTGATGCTGGTAAAAAAGAAGACCATATTCGCGATATTTTCTACAGA
ATG
GGCTTCAATGACCAAGAGATCGTTGCTTTAGCTGGTGCTCATGCTTTGGGTCGTTGCCACCCTGACCGCAGTGGATTTGAGGGCCCATGGCAAGAAGCCCCCACTGTCTTCTCTAAC
GAATATTTCAAGGCCATCTCTACTCGCAAATGGGTCAAGAAGGACTTGAAGAACGGTGGCTGGCAATGGGTCGATAAGAACAACACCGATGTTATGATGTTGCCTGCTGAAATTGCCATG
TACAACGACAAGGAATTCAAGAAATACTTTGACTTGTATGCCAAGGATGAAGACAAGTTCTTTAAGGATTTCGCCGCCGTATTCCAAAAGCTCCTTGAATTGGGTGTTCCCTTCAAGGGT
GATGAAAAGGTGTACCACTTTAAGCGTACCACCGAGTAA

Retrieve as FASTA