Entry information : EguAPx10
Entry ID 11385
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-25 (Christophe Dunand)
Peroxidase information: EguAPx10
Name EguAPx10
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguAPx10
start..stop
S start..stop
EglAPx10 509 0 1..250 1..250
EgrAPx10 508 0 1..250 1..250
EcamAPx10 504 0 1..248 1..248
EgrAPx03 456 9e-166 1..250 1..249
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24611..24729 119 N° 2 24840..25014 175 N° 3 25186..25251 66 N° 4 26051..26099 49
N° 5 26198..26283 86 N° 6 26498..26577 80 N° 7 26672..26774 103 N° 8 26849..26907 59
N° 9 27005..27020 16  
join(24611..24729,24840..25014,25186..25251,26051..26099,26198..26283,26498..265 77,26672..26774,26849..26907,27005..27020)


exon

Literature and cross-references EguAPx10
Protein sequence: EguAPx10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27059.85  
PI (pH):   %s   6.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSEEYKKXVEKCKKKLRGLIAEKSCAPLMLRIAWHSAGTFDVKTKTGGPFGTMKHAAELSHGANSGLDVAVRLLQPIKDQFPIITYADFYLAGVVAVEVTGGPEVAFHPGREDKPQPPPEGRLPDATKGCDHLRQVFGVQMGLSDKDIVALSGGHTGRCHKERSGFEGTWTANPLIFDNSYFKELLSGEKKELLQLPSDKALLADPVFRPLVEKYADEDAFFEDYAEAHLKLSXLGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Scaffold_10_33790 (24611..27020).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCNTACCCGACCGTGAGCGAGGAGTACAAGAAGGNTGTCGAGAAATGCAAGAAGAAGCTGAGAGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TACGATCTCTCTCTCTCTCTCTCTTTCTCTCTTTGACTGGCGATCTCATGGTGCGAGGATTTGTGTGACGTTGGGTGTTTATGTGGGTGTGTGTGTGTGCGTCGTGCAGGTGGCACTCCG
CCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGCTCTTGCAGCCGA
TCAAGGATCAGTTCCCCATCATCACTTATGCTGATTTCTACCAG
GTCNGTTTCTTTGTTCTGTTTTTAACTATGCGGACATAGGNAAGAGCGGGCCTTGCGATCGGGTTGTTTTGATGGC
TTTAAAGCATTCATATGCAGCGGTNGACGGCCATTTCGTTCCGAATAATATGCATTTATGACCTTGACTTGATGATGTTGTCCAATGTGATACAGCTGGCTGGCGTCGTTGCTGTGGAAG
TTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GTCGGTGATCTTGTTTGCTTTCTTTTTATCGTAGCAGGATCTATGTTTTCCTATATGATCTATATACACACAGATGTGA
TGTGATTTATGTTTNCAAGAGTTGCAATGTCGATGTGTCTAGAAGCAGAAGAGGGTTGATGAAGATCAGTGCAATTCTACTATTATCAAGCAGAAAATAGTTATTATATTAACCAAAACC
GTTTGGTCGTTACATGGTATCTGGTTTGATGCCTTCTCTCATTAGGCATGTTAAAATTATTTACANCTGTTGTTCTTTTGCCCCTTTAACCTGATCACTTGGATCTTATGTTTCTTTCAT
GGAATTGTGGGTGANATATTGACGTTCTGATGGTGAAGTAAAACCATTCACTTGTTTTTAGGTTCTTTCTTTCAGGAAACTTCANTATATATATGTATGTATGTATGTATTCTTCAGCTC
ACTTTAAAGCTACACTGTTGTGTGTTTTGGTTAGCTGAACTTGGTAGTGCAAGCCTGGGCACTTGTGCTCCCTCTTCNTCATAGCATATAAGTGCTGTAATGATNTCTGAAAATTTCCAA
AAGATCTACTGATATGCTTTGAGATATGTAAGCCACGTGAGGCCTCTCCTTATGGATTTCTGATCAGATGCTGTACTGTGATTTGTGCTGTCAATGGCCCAGAAGCTTTTGCTTTCTCTC
GGTTCACATCTTTTTTTATACTTTCTTNGCAATTTNCCATAATTTCTGTTAGCTTTAATTNTGATGCTTGCTACTTTGTTATTTATCTGGCATATTTTCACATTTTTCCACCAAATCCAG

GACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGG
GTTAGTTTTATGTCTAGCATTTCCAGTATTTTGTCTTCATGCTTTTAGATTCTTGATTGAATGTTAATCTA
TCGTCGTGTCTTCGACATTTCTTGCAGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCTGGTGGCCATACCCTGGTTTGTG
CTCAAACCTTAGATCCTCTCTTGAATTCTGATTTTGTTAAGTAGGATACTATTTGTAGCAAGTTGCNNTCATATGTCATCCTATTTGCCTACAAATTATATTGGTTTTATTCTCCTTCGT
GGTGATATGCTCTGTAAGTTCTGATGTAATTATTCANTTATTGCATTGAGTTCATTCCTTTGCTCTTTTGGTGGCACTCAATAACAGGGAAGGTGCCACAAGGAGAGGTCTGGATTTGAG
GGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAA
GTGAGGCTTCTAATCTTCCCGTTTTTAATCCATTGTCGGATAAAGTAATTGCCGACTTCATGCTCATGNGGTG
ACTGTTTGAATCTTNGACTAGGGAATTGTTGAGCGGAGAGAAGAAAGAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGAGAAATATGC
TGCG
GTGTGTGTTTTTCTCTTGTCGAGAATTGCTGTGCTGTTGTATGCTGGAGCTCATTGACTTTCCTTTTGATTTAGGATGAAGATGCCTTCTTTGAAGACTATGCTGAAGCCCATCTG
AAGCTCTCTGANCTAGG
GTACTCTTTGAATTTTGATGGTCATTCTACACTTACTNTATACTTTAGTCGATTTCTTTGGCCAATATTGTCATTGAACTCTTGACTTNTTTCGCAGGTTTGC
TGATGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCNTACCCGACCGTGAGCGAGGAGTACAAGAAGGNTGTCGAGAAATGCAAGAAGAAGCTGAGAGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TGGCACTCCGCCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGCTC
TTGCAGCCGATCAAGGATCAGTTCCCCATCATCACTTATGCTGATTTCTACCAG
CTGGCTGGCGTCGTTGCTGTGGAAGTTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCT
GGTGGCCATACCCTG
GGAAGGTGCCACAAGGAGAGGTCTGGATTTGAGGGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAAGGAATTGTTGAGCGGAGAGAAGAAA
GAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGAGAAATATGCTGCG
GATGAAGATGCCTTCTTTGAAGACTATGCTGAAGCCCATCTG
AAGCTCTCTGANCTAGG
GTTTGCTGATGCCTAA

Retrieve as FASTA