Entry information : EguGPx01
Entry ID 11391
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2016-04-06 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-04-07 (Catherine Mathe)
Peroxidase information: EguGPx01
Name EguGPx01
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguGPx01
start..stop
S start..stop
EglGPx01 413 5e-150 1..202 1..202
EgrGPx02 405 7e-147 1..202 1..202
EgrGPx01 401 2e-145 1..195 1..195
EcamGPx01 395 3e-143 1..192 1..192
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5721..5870 150 N° 2 6589..6665 77 N° 3 7079..7140 62 N° 4 7244..7362 119
N° 5 7710..7877 168 N° 6 7954..8019 66  
join(5721..5870,6589..6665,7079..7140,7244..7362,7710..7877,7954..8019)


exon

Literature and cross-references EguGPx01
Protein sequence: EguGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   203 (176)
PWM (Da):   %s   22651.51 (19464.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.01 (7.18) Peptide Signal:   %s   cut: 27 range:27-202
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQWFKSPSFFPFLFALLALSVYFFNAHRPASRAPEMAEESSKSIYDFAVKDIRGNDVSLSEYSGKVLLIVNVASKCGLTQSNYKELNTLYEKYKDGFEVLAFPCNQFAGQEPGSNEEIQETVCTMFKAEFPIFDVEVNGKNAAPLYKFLKSQKGGIFGDGIKWNFTKFLVNREGKVVERYAPTTSPLKIEKDIXNLLGSSVTCPAMLIKIT*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Scaffold_1_49 (5721..8018)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GTGCCTTTTTCTTTTTTCTTTTGAGATGTCGACTGGGATGATGGGTGGTGCTTATCCTGTTCTGTCTGCTCTTGGGTTGGAGAGGCGAGA
GGGTTTAGAGGCTGCGCTATGTGCAAGATTGGAACTTAGCGTGCGGTCGAAGATGGGTCCTTTTTTTTTTTTTTTTTTTTTTGGGGGGGGGAGGGGGAGCGGAGATTTCAGCTGTCCCCA
TGGGCGTACGGGCTGATTGGGTTTGAGATGGTGATTGCTTGCGCGTACTCGGTCAGAAACTAACGGCGTCGTTGAAATTCCTAANCAAGGACNAGCCTTGNTCGGTTTGTTTGTTCTGCG
GCGTGTCGTTAACATGTGATGTGCCCGTTCCATGAAACGCTTGTTTGTAATTCTANTGCTTTTCTTCTGCAACTACGAACTGGCGGGTCGATGACCTGAATGTGGGAGTTAGGTTGAGTA
TCGATCGGATCATGAATCTTTTGCTTTATCACAATTTCTTAGTCAATCCATAATTTNCCTTGAATCCTAATACTGACGATTTTGAATCTTGTTCGGTCTTCTTTCAACTTGATACGGATC
CCTGTTTGTACGTTCGTTTCTGCNGAAGAGGTGGATATGCCATATTGTGCTTCTTNCGTTGTAGAAATTTATTTGATGTAGCTTTTCATGGTTTTTATAGTTAGAGATATTTATGANTGT
AGATGTCAATTATCTGATGCATATGCAGGACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGGTATCGCCACTGAAT
GCGCCTTCTCTTCAAGAATTGTGTTTCTTTGATTAGAACCTCGATAGGAATTTAGCGACTCAAGCGTTCATGATATGGTTTAGTAGTTGACTAGTTGGTCCTGTTGTATGTCGCTATGTG
TTTGACTGCATGCAGAACACTTGCATGTCCAATCTTGAACCTGTTATCACTCTTTTGGTAGTTTAAACAGCATGAGCCTNCGTCGATCCCNTAAGCCTGGGGCTGCTTCTCTTTCCCCTT
TAACGGCTATGCATAGATCTATTAACCATTTGTTCTAGATGTAATTGAGTGGCCAATTGTTAAATCCAGTTCATGTTCCCAGTAACAGTCAACTCCTTGAACTTATATCATCTGCTTTGA
TACTTATGATATCTAATATAGCGCACACATGTTTGCAGTGGTCTCACCCAATCAAATTACAAGGAATTGAATACTTTATATGAAAAATACAAGGATCAAGGTTTGCTCTTTGGTCTTTTG
TGTTTTGATTTCGTTCTCATATGTTTTACTCTGCGCCATATCCTTGGGGTTTGTATAGGTTCATGACTGACATTTCTTTGCAGGATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGC
AGGACAAGAGCCAGGGAGTAATGAAGAGATTCAAGAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTAAACATGAGAAGCCCAAAANAATGAGAAAAATATTA
AATTGAAAGGGAATTCTTGATATTCTGGCTCCTCATGCTTTTTGGTCGTTTTAACTTGAGAGCACTATCAATCTCATNGTACGCATAAAAATTGATGATTGACCAGTTCCAGATGAGGTT
GAGAATTTGCTTGCAATGTGTTTCATTTTCTCTTTCCACAGTGTGATAAAAGAGACTTGTTCTATATGCAAGTTCAAGTTGCATAANCGTCCTCCTCTTTTGCAAATTTGACTCTGTACA
ATATGGAGAAAAGATGTTCTGAGTTGATATTACACTCTATTTTTGATATTGTAGTCTATTGTGCTACAGGTTGAGGTGAATGGCAAGAATGCAGCCCCNCTCTACAAGTTTTTAAAATCT
CAGAAAGGAGGGATATTTGGAGATGGCATCAAATGGAACTTTACAAAGTTTCTGGTNAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAG
GTT
AGGGATCTGATTTACAACAATGCGAAAGAGCAATTTAAGTCGAATCTAATTTATTTTTTCNGTTATCCTGCAGAAAGATATCCANAATCTGTTGGGATCGTCTGTCACCTGCCCAGCAAT
GCTAATCAAAATTACTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGTGGTCTCACCCAA
TCAAATTACAAGGAATTGAATACTTTATATGAAAAATACAAGGATCAAG
GATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAA
GAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTTGAGGTGAATGGCAAGAATGCAGCCCCNCTCTACAAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGA
GATGGCATCAAATGGAACTTTACAAAGTTTCTGGTNAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAG
AAAGATATCCANAATCTGTTGGGA
TCGTCTGTCACCTGCCCAGCAATGCTAATCAAAATTACTTAG

Retrieve as FASTA