Entry information : EguPrx04
Entry ID 11412
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2012-12-19 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-26 (Christophe Dunand)
Peroxidase information: EguPrx04
Name EguPrx04
Class Class III peroxidase    [Orthogroup: Prx058]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx04
start..stop
S start..stop
EgrPrx04 689 0 1..334 1..334
EgrPrx13 683 0 1..334 1..334
EcamPrx04 661 0 5..334 1..330
EcamPrx15 614 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 162..407 246 N° 2 607..792 186 N° 3 926..1085 160 N° 4 1380..1792 413
join(162..407,607..792,926..1085,1380..1792)


exon

Literature and cross-references EguPrx04
Protein sequence: EguPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (312)
PWM (Da):   %s   37499.95 (35043.7)  
PI (pH):   %s   6.62 (6.25) Peptide Signal:   %s   cut: 23 range:23-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRASMWWHLLLSVLTLVSSCAAWRVEAEATIKLPPPLQWHFYQNSCPDVERYVRDQVEFYWKQDSTLAVKLIQLLYTDCFIKGCDASILLDGPDTEKTAPQNAPILGFPLEVIDKVKEVLEQHCPGVVSCADIINLAARDAVVLAGGVSYPVPTGRRDGNSSSAKLVDIAVHATPWEKVIHYFEVRGMNVFDVTTLLGGHTLGRTRCKFIAERLYDFNNTGKPDQSMDPSFLAELRVQCPPNSTNSVYLNPDSGSSNRFGKTFYSRVLNHRAVLSIDQQIADREESLQIARRYDANFEDFLKMFGYAMTKLGNTWLLPGDQGEIRKNCRVVNRK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). containing motif YTDC instead of FHDC.
scaffold_1_269 (162..1792)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCATCTGTTGCTATCGGTGCTCACGTTGGTGAGCTCGTGCGCGGCGTGGCGCGTTGAGGCCGAGGCGACGATCAAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCATGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCCGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GTACGTACCGTCTGCTCATTTCCCTCTCTCTCTCTCTCTCTCAAACGATCTCAAAGTCAGCATCGCTTCGATCATCGAGTTTCTGTCGCCCCCTCTGAGCATGCCATATACTTT
CACCCAATGGTTTAACCTCTCGGACTCGTCTTTCTAGCATACCAATCTTTTCTGAACATATGTATGGTTTATGTGGATAAAAAAGGGATGCGATGCGTCGATTCTCTTGGACGGGCCAGA
CACAGAGAAAACAGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGGTCAAGGAAGTTCTGGAACAGCACTGTCCCGGGGTCGTCTCTTGCGCCGACATTAT
CAACCTTGCCGCTAGAGACGCTGTCGTCTTG
GTATGCAACATGGTTCTCAGTTTTTCCTTTTTGGGCTGGAAAAGAGATATGCTGTTAGCTTGAGTTTTGGAGCGTTCGATATGGACAGA
AAAAAAAAATCAGAATTACTGATGTGATAATGATGTTGTAATAGGCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAATTCGTCCAGTGCGAAGTTGGTGGACATCG
CAGTGCACGCCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GTACGGTCTAACTCTCGAATGAAAAGTGTTTATTTG
ACTCCGACCTCATTACATTACCTTAAGATCTTAACCAATTCAGGCAACTCATTTAATTCAGTGAATCAAGCTGTCCATTTAGCTTTCGCTAAGTCGAAGAATTTTATCAGATATAGAATC
GTCGAGGATGTAATCCGAAGCAATCCTCATAATGATCTCCTCCAAGTGCACAAAAATGGCATGCTCACGTAATATATCAATCTCTCAATCATAACCAATTCCTCCTTACTTTGCCAAAAA
CAATTTAAATTTTGCCAGGGGGCCATACACTGGGCAGGACCAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTCT
TGGCCGAATTGAGGGTGCAATGCCCGCCCAACTCAACGAATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGTG
CCGTCCTCAGCATCGACCAGCAGATCGCCGACCGTGAGGAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTGG
GGAACACCTGGCTCCTGCCAGGGGATCAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACAGGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCATCTGTTGCTATCGGTGCTCACGTTGGTGAGCTCGTGCGCGGCGTGGCGCGTTGAGGCCGAGGCGACGATCAAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCATGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCCGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GGATGCGATGCGTCGATTCTCTTGGACGGGCCAGACACAGAGAAAACAGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGGTCAAGGAAGTTCTG
GAACAGCACTGTCCCGGGGTCGTCTCTTGCGCCGACATTATCAACCTTGCCGCTAGAGACGCTGTCGTCTTG
GCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAAT
TCGTCCAGTGCGAAGTTGGTGGACATCGCAGTGCACGCCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GGGGCCAT
ACACTGGGCAGGACCAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTCTTGGCCGAATTGAGGGTGCAATGCCCG
CCCAACTCAACGAATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGTGCCGTCCTCAGCATCGACCAGCAGATC
GCCGACCGTGAGGAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTGGGGAACACCTGGCTCCTGCCAGGGGAT
CAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACAGGAAATAA

Retrieve as FASTA