Entry information : EguPrx134
Entry ID 11445
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EguPrx134
Name EguPrx134
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx134
start..stop
S start..stop
EglPrx134 671 0 1..329 1..329
EgrPrx134 670 0 1..329 1..329
RcPrx21 550 0 23..329 28..334
VvPrx04 546 0 9..329 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5426..5641 216 N° 2 5764..5964 201 N° 3 6088..6253 166 N° 4 6762..7168 407
join(5426..5641,5764..5964,6088..6253,6762..7168)


exon

Literature and cross-references EguPrx134
Protein sequence: EguPrx134
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35445.73 (32649.4)  
PI (pH):   %s   8.9 (9.12) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALFRLFALWSLAICFCLCPHTTSAQLRQNFYANVCPNVEGIVRNAVRQKFQQTFVTVPGTLRLFFHDCFVQGCDASVIVASTSTNKAEKDHPDNLSLAGDGFDTVIKAKAAIDAVASCRNKVSCADILAMATRDVIALSGGPSYAVELGRLDGLSSTAASVNGRLPHPTDNLSQLNALFAANGLSQTDMIALSAAHTLGFSHCDKFSNRIYNFSRQKPVDPTLNPNYATQLQGMCPRNVDPRIAINMDPNTPRTFDNMYFKNLQNGKGLFTSDQVLFTDPRSKPTVNAWASNSPAFQSAXVSAMTKLGRVGVKTGKNGNIRRDCAVFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Scaffold_9_31760 (5426..7168).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGTTCCGACTCTTCGCGCTGTGGTCGCTGGCCATATGCTTCTGCCTCTGTCCTCACACGACGTCAGCTCAGCTGAGGCAGAACTTCTACGCCAACGTCTGCCCGAATGTGGAG
GGCATCGTGCGCAATGCCGTTCGACAGAAGTTCCAGCAAACATTCGTCACTGTCCCCGGAACTCTTCGTCTCTTTTTCCATGATTGCTTCGTCCAG
GTAATTTCGATTCCCCCCATGATT
GACTTTGAAGACCCATTTGGTCATTTTTCGTTCGAGATTGACCAATCAGCAATCTTTTATTGGCCTTTCGTGTTTTGGGACTTGGTTTGGATCGATAGGGTTGTGATGCTTCGGTGATAG
TGGCGTCCACCTCAACCAACAAGGCGGAGAAGGATCATCCAGACAACCTGTCGTTGGCCGGAGACGGGTTCGACACTGTGATAAAGGCGAAGGCGGCCATCGACGCAGTCGCGAGCTGCC
GGAACAAGGTCTCGTGCGCGGACATCCTAGCCATGGCCACCCGAGATGTCATCGCACTG
GTGGGTGTGCTAATTTCTCACGTTGAAATAGTTTTCGAGTCATCACAATGCCGATCGTTGT
GACCCGAATGTCGATCTTGGTGCTGTGCATGAAATTGAACAAGCGAATTGGTNAAATTGCAGTCGGGAGGGCCGTCCTATGCAGTGGAATTAGGGAGATTGGACGGGCTGAGTTCAACGG
CGGCGAGCGTCAATGGGAGGCTCCCTCATCCGACCGACAACCTTAGCCAGCTCAACGCCTTGTTTGCTGCTAATGGCCTCTCCCAAACTGACATGATCGCACTCTCAG
GTAACCGCGCGT
GCTCAGCACGGTCCCATCGCATGTAGATGTATAAAGTGAATACAACATGGNCAACTATTCAATAAATTAACTTGGANAGTTTCTAGTAATTACTAAATATGCTCCTTAAATTTATAACCC
CTTATCGAGGGGTGCTACTGCTTCATCATGTGATCGAATTTGTTTGATAGACTATTAAGTTAATCGTTATCACCATATTATCCGATATATACTTCAAGAAACGTGAATTTATTNGTTTTT
TTAATTGATCAAACAAACTATAAAACANGAGCCGGCGAGATTGCCCCGATCAGAGATGGTACATTGCTGACAAACCATTATAAGTATGTGCAACTAGAACATGGAAAGGGTCAATTATAT
AATGAGATTTGGTGAATTTGATGCATGTCATCTTGCTGTCANTCAATAATATTATANACATTATTGTCATATCTATCTTTACAACATGATTAGGTGTCCCAATCTATTTGTCTTGTTATC
CATGGTCATTTTACAGCTGCCCACACGCTCGGATTCTCCCACTGCGACAAATTCTCGAACCGGATATACAACTTCAGCCGCCAGAAGCCGGTGGACCCGACCCTGAACCCGAACTACGCG
ACCCAGCTACAGGGCATGTGCCCCCGGAACGTCGACCCGAGGATAGCCATAAACATGGACCCGAACACCCCCCGGACCTTCGACAACATGTACTTCAAGAACCTGCAAAACGGGAAGGGC
CTTTTCACCTCGGACCAAGTCCTCTTCACTGACCCGCGGTCAAAACCCACCGTGAACGCATGGGCCAGTAACTCCCCGGCCTTCCAGAGCGCCTTNGTCTCCGCCATGACCAAGCTGGGC
CGGGTTGGGGTCAAGACCGGGAAGAACGGAAACATCCGCCGCGACTGCGCCGTATTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGTTCCGACTCTTCGCGCTGTGGTCGCTGGCCATATGCTTCTGCCTCTGTCCTCACACGACGTCAGCTCAGCTGAGGCAGAACTTCTACGCCAACGTCTGCCCGAATGTGGAG
GGCATCGTGCGCAATGCCGTTCGACAGAAGTTCCAGCAAACATTCGTCACTGTCCCCGGAACTCTTCGTCTCTTTTTCCATGATTGCTTCGTCCAG
GGTTGTGATGCTTCGGTGATAGTG
GCGTCCACCTCAACCAACAAGGCGGAGAAGGATCATCCAGACAACCTGTCGTTGGCCGGAGACGGGTTCGACACTGTGATAAAGGCGAAGGCGGCCATCGACGCAGTCGCGAGCTGCCGG
AACAAGGTCTCGTGCGCGGACATCCTAGCCATGGCCACCCGAGATGTCATCGCACTG
TCGGGAGGGCCGTCCTATGCAGTGGAATTAGGGAGATTGGACGGGCTGAGTTCAACGGCGGCG
AGCGTCAATGGGAGGCTCCCTCATCCGACCGACAACCTTAGCCAGCTCAACGCCTTGTTTGCTGCTAATGGCCTCTCCCAAACTGACATGATCGCACTCTCAG
CTGCCCACACGCTCGGA
TTCTCCCACTGCGACAAATTCTCGAACCGGATATACAACTTCAGCCGCCAGAAGCCGGTGGACCCGACCCTGAACCCGAACTACGCGACCCAGCTACAGGGCATGTGCCCCCGGAACGTC
GACCCGAGGATAGCCATAAACATGGACCCGAACACCCCCCGGACCTTCGACAACATGTACTTCAAGAACCTGCAAAACGGGAAGGGCCTTTTCACCTCGGACCAAGTCCTCTTCACTGAC
CCGCGGTCAAAACCCACCGTGAACGCATGGGCCAGTAACTCCCCGGCCTTCCAGAGCGCCTTNGTCTCCGCCATGACCAAGCTGGGCCGGGTTGGGGTCAAGACCGGGAAGAACGGAAAC
ATCCGCCGCGACTGCGCCGTATTCAACTGA

Retrieve as FASTA