Entry information : EguPrx144
Entry ID 11452
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EguPrx144
Name EguPrx144
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx144
start..stop
S start..stop
EgrPrx144 635 0 1..325 1..325
EcamPrx144 607 0 20..325 1..306
RcPrx36 508 0 10..325 11..326
PtPrx76 498 1e-179 15..325 7..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1307..1729 423 N° 2 1017..1182 166 N° 3 490..875 386  
complement(join(490..875,1017..1182,1307..1729))


exon

Literature and cross-references EguPrx144
Protein sequence: EguPrx144
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (295)
PWM (Da):   %s   34349.03 (31304.6)  
PI (pH):   %s   7.84 (7.68) Peptide Signal:   %s   cut: 31 range:31-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTPGAAASSCRFAIFSSMLVLLCMSCHAQLSSTFYDESCPDALAAIRTSIRTAVSRERRMAASLIRLHFHDCFVQGCDASILLENSPTISSEKDVGPNRGSVRGYEVIDDAKSEVEKICPGVVSCADIVAVAARDASVAVGSPSWTVKLGRRDSTTASPSLASSDLPSFQDGLERLVSRFAIKGLSARDMVALSGAHTLGQAQCSTFRDRIYSNGSDIDAGFASTRKRRCPASGGDATLAPLDLVTPNSFDNNYFKNLMQKKGLLESDQVLFSGGSTDSIVSDYSKKPASFKSDFAAAMIKMGDINPLTGSSGQIRRICSAL

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3). Scaffold_9_33202 (1729..490).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACCCCTGGCGCTGCTGCGTCCTCCTGTCGCTTCGCGATATTCTCTTCGATGCTAGTGCTCCTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCG
TGCCCCGATGCCCTCGCCGCGATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAGCGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTTGTCCAGGGTTGTGAT
GCGTCGATACTGCTGGAGAATAGCCCCACCATCTCTAGCGAGAAAGACGTGGGGCCAAACAGAGGCTCCGTGAGAGGTTACGAGGTGATTGACGACGCCAAGTCCGAAGTGGAGAAGATC
TGTCCAGGAGTCGTGTCTTGCGCGGATATTGTTGCCGTCGCAGCTCGAGATGCTTCTGTTGCC
GTAAGTCTTCCCATAGTTCTCAAGATATGCATCTTATGATCACTTGATTACTTTCAA
ATATCGACTACGAGTTTAAATCATTTTCCTTACTGATATAACTGATGCTGCTGTGACAAAAATGTAGGTTGGCAGTCCTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGC
AAGCCCATCTCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGAGACTCGTATCTCGATTTGCAATCAAGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTATATA
CGAAATGCTTATTCAAACCTGACGATGGAGCTTGGCCTATGCAAGAATTTCTCATTCTTGCTCACAAGCTCGAATGATATTGAATAAAAGGGAAAAATAATGTTGATGTGCCCTTTTCTG
CCAACGTTATGCAGGTGCTCACACTCTAGGGCAAGCTCAGTGCTCCACGTTCAGGGACAGGATCTACAGCAACGGCAGCGACATCGACGCGGGATTCGCCAGCACTCGTAAGCGCCGGTG
CCCGGCAAGCGGCGGCGATGCCACTCTAGCCCCACTCGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCAAGAATCTGATGCAGAAGAAAGGCCTCCTCGAGTCGGACCAAGT
CCTTTTCAGCGGAGGTTCCACCGACAGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCCGATTTTGCGGCTGCCATGATTAAGATGGGCGACATAAATCCGCTCACCGG
TTCAAGTGGCCAGATCAGGAGGATTTGCAGTGCTCTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAACCCCTGGCGCTGCTGCGTCCTCCTGTCGCTTCGCGATATTCTCTTCGATGCTAGTGCTCCTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCG
TGCCCCGATGCCCTCGCCGCGATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAGCGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTTGTCCAGGGTTGTGAT
GCGTCGATACTGCTGGAGAATAGCCCCACCATCTCTAGCGAGAAAGACGTGGGGCCAAACAGAGGCTCCGTGAGAGGTTACGAGGTGATTGACGACGCCAAGTCCGAAGTGGAGAAGATC
TGTCCAGGAGTCGTGTCTTGCGCGGATATTGTTGCCGTCGCAGCTCGAGATGCTTCTGTTGCC
GTTGGCAGTCCTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGCAAGC
CCATCTCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGAGACTCGTATCTCGATTTGCAATCAAGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTGCTCACACT
CTAGGGCAAGCTCAGTGCTCCACGTTCAGGGACAGGATCTACAGCAACGGCAGCGACATCGACGCGGGATTCGCCAGCACTCGTAAGCGCCGGTGCCCGGCAAGCGGCGGCGATGCCACT
CTAGCCCCACTCGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCAAGAATCTGATGCAGAAGAAAGGCCTCCTCGAGTCGGACCAAGTCCTTTTCAGCGGAGGTTCCACCGAC
AGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCCGATTTTGCGGCTGCCATGATTAAGATGGGCGACATAAATCCGCTCACCGGTTCAAGTGGCCAGATCAGGAGGATT
TGCAGTGCTCTAAAT

Retrieve as FASTA