Entry information : EguPrx153
Entry ID 11459
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2013-01-22 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-25 (Christophe Dunand)
Peroxidase information: EguPrx153
Name EguPrx153
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx153
start..stop
S start..stop
EgrPrx153 651 0 1..315 1..315
EglPrx153 646 0 1..315 1..315
EgrPrx154 646 0 1..315 1..315
EglPrx154 642 0 1..315 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33527..33706 180 N° 2 33966..34730 765  
join(33527..33706,33966..34730)


exon

Literature and cross-references EguPrx153
Protein sequence: EguPrx153
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315
PWM (Da):   %s   33736.78  
PI (pH):   %s   8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSFITFLNSGSATLQVGFYRSTCPSAESVVRKAVNKAVAKNPGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPSEKEHPANNPSLRGFEVIDEAKAELESLCPQKVSCADILAFAARDSAYKLGSINYAVPAGRRDGLVSLKDEPSQNLPPFFFNAQQLEANFASKGLSLDEMVTLSGAHSIGVSHCSSFSDRLYSFNATHTQDPSMDTKLATQLKSKCPNNGGASDPTVPLDLVTPNRLDNKYYTNLKNHRGLLTSDQTLFNSPSTANIVRSNANNGGAWANKFAAAMVKMGSIDILTGNEGEIRRKCTVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). Scaffold_10_34441 (33527..34730).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCGTCTGCGGAGTCCGTCGTCCGGAAAGCTGTGAACAAAGCGGTGGCC
AAGAATCCCGGCATCGGTGCTGGGCTCATTAGAATGCATTTCCATGATTGCTTCGTTCGG
GTATGAATGGACTTTTTTGCACATTTCGGAAAATAGTAACTCGAGGAAAACCATTTTCTA
GCAAAAAGCGTACGCCTATTTTTCGTTGGTACAAAAGATATTGATGAGATGTGTGTGCGGAGTAAATTTCACATTCTATCACGAGTCCAGGACGTTTAAGTTTAGTCTAACTTGACGGCC
ACAAAATAATTATGTTTCTTATACTGATGCACTTCAGCTATCCTTATAATTAATTGGCTGATCTTTGATCCGATAATAGGGTTGCGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAA
CCCATCAGAGAAGGAACATCCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCT
TGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGAATCTGCCTCCTTT
CTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGA
CCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTACTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATT
GGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGACCCTTTTTAACAGCCCTTCGACGGCTAACATCGTGAG
GAGCAATGCAAATAATGGCGGAGCATGGGCAAACAAGTTCGCGGCAGCAATGGTGAAGATGGGATCGATCGACATCCTCACCGGGAACGAGGGTGAGATTAGGAGGAAATGCACGGTGGT
GAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCGTCTGCGGAGTCCGTCGTCCGGAAAGCTGTGAACAAAGCGGTGGCC
AAGAATCCCGGCATCGGTGCTGGGCTCATTAGAATGCATTTCCATGATTGCTTCGTTCGG
GGTTGCGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAACCCATCAGAGAAGGAACAT
CCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGAC
AGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGAATCTGCCTCCTTTCTTCTTCAATGCGCAACAA
TTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGACCGCTTGTACTCCTTCAAT
GCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTACTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAAC
AGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGACCCTTTTTAACAGCCCTTCGACGGCTAACATCGTGAGGAGCAATGCAAATAATGGC
GGAGCATGGGCAAACAAGTTCGCGGCAGCAATGGTGAAGATGGGATCGATCGACATCCTCACCGGGAACGAGGGTGAGATTAGGAGGAAATGCACGGTGGTGAAC

Retrieve as FASTA