Entry information : OsPrx136 (Os12g02060)
Entry ID 1146
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2010-08-03 (Marie Brette)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Christophe Dunand)
Peroxidase information: OsPrx136 (Os12g02060)
Name (synonym) OsPrx136 (Os12g02060)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx136
start..stop
S start..stop
OsPrx131 622 0 1..317 1..317
SiPrx61 594 0 1..317 1..317
SbPrx86 578 0 1..317 1..317
OsPrx57 474 2e-170 3..317 4..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 613316..613525 210 N° 2 613611..613802 192 N° 3 614067..614232 166 N° 4 614460..614845 386
join(613316..613525,613611..613802,614067..614232,614460..614845)


exon

Literature and cross-references OsPrx136 (Os12g02060)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1F7
DNA ref. GenBank:   NC_008405.1 (613316..614842)
Protein sequence: OsPrx136 (Os12g02060)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   33719.69 (31445.5)  
PI (pH):   %s   7.68 (7.36) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPKPFACSAIALLFAANLVSAQLSANFYDKSCPNALPTIRIAVRSAIARENRMGASLLRLHFHDCFVNGCDGSVLLDDTPTFTGEKTAAPNNNSLRGFDVIDNIKAHIEGICPQVVSCADILAVAARESVVALGGPTWVVQLGRRDSTTASLDTANNDIPAPTFDLGDLTKSFSNKGLSATDMIALSGAHTIGQARCVNFRNRIYSETNIDTSLATSLKSNCPNTTGDNNISPLDASTPYAFDNFYYKNLLNKKGVLHSDQQLFNGGSADSQTTTYSSNMATFFTDFSAAMVKMGNINPITGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 12, 3 introns). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCTAAACCCTTTGCTTGCAGTGCCATTGCCTTGTTATTTGCTGCAAACTTGGTGTCAGCTCAGCTTAGCGCAAATTTCTATGACAAATCATGCCCTAATGCACTGCCCACC
ATCCGAATAGCCGTGAGATCTGCCATCGCAAGGGAGAACCGCATGGGTGCATCATTGCTCCGCCTCCACTTCCACGACTGCTTTGTCAAT
GAAAGTGTCCTGAACCTGCAGAGATATTCA
AAATTTTCTCACTTCTAAGTATTACGTAATAACCTTCAGTATTCTGACAATGCAGGGTTGTGATGGCTCGGTGCTGCTAGATGACACTCCAACATTCACTGGAGAGAAGACCGCTGCTCC
AAACAACAACTCTCTGCGTGGATTTGATGTTATAGACAACATCAAGGCACATATTGAGGGGATCTGTCCGCAGGTGGTCTCATGTGCTGACATCCTTGCTGTGGCGGCACGCGAATCTGT
TGTTGCG
GTAAGGGGAGAAAATACAAAGGATATCAAACTAAAAGTTAGTTATTTGTCTGTCTTAAAAAGTTAACAGGAACTCCTGACGTCAGAAGATGAGCAACTGAAATGAACAAAACA
TAACTCTTTATGTATAGCTATGAAATTCTATACCAAAACAAGCCTTACAAAGTATTAAAAGTCAAGTTGCCAAAGATAGTAAAATAAATTAATTGATATTTATAAAATACAATCAGTAGT
GACATATGAAAACCGACAATTTATTTTTCAGCTAGGAGGTCCTACTTGGGTTGTCCAGCTGGGACGGCGCGACTCAACAACAGCAAGCCTGGATACTGCAAACAATGACATTCCAGCTCC
AACCTTTGACCTTGGTGATCTCACGAAGTCTTTTTCAAACAAAGGACTAAGCGCAACTGACATGATTGCACTCTCAG
GTACTGTGTATGTAAATGGAACTTTTTGGTATATAATACCATC
TATAATAAAACCATAAAATAAAACAGCTATCCTTGCTGAAGCTTGATTGTCAAAACAAACTGTACAAGTGGTGTTACATTTATGTAGGAGTATCAATATATCATGGTGCAACCCCAACAG
GTTGTTTAGTATCAAGATGCTACTGATCAATTGATCACTAACATCAAATAAAAATATATGCCAGGGGCTCACACCATAGGCCAGGCAAGGTGCGTCAATTTTCGCAACCGCATCTACAGT
GAGACCAACATCGACACTTCCCTGGCAACATCTCTGAAATCAAATTGTCCAAACACGACTGGCGACAACAACATATCCCCCCTTGATGCATCGACGCCCTACGCCTTTGACAATTTTTAC
TACAAGAACCTGCTGAACAAGAAGGGTGTCCTGCATTCTGACCAGCAACTATTCAATGGTGGTTCAGCAGATTCCCAGACGACCACCTACTCATCAAACATGGCAACATTCTTCACTGAT
TTCAGCGCAGCAATGGTGAAGATGGGCAACATCAACCCCATTACTGGATCTAGTGGACAGATCAGGAAGAACTGCAGGAAGGTAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCTAAACCCTTTGCTTGCAGTGCCATTGCCTTGTTATTTGCTGCAAACTTGGTGTCAGCTCAGCTTAGCGCAAATTTCTATGACAAATCATGCCCTAATGCACTGCCCACC
ATCCGAATAGCCGTGAGATCTGCCATCGCAAGGGAGAACCGCATGGGTGCATCATTGCTCCGCCTCCACTTCCACGACTGCTTTGTCAAT
GGTTGTGATGGCTCGGTGCTGCTAGATGAC
ACTCCAACATTCACTGGAGAGAAGACCGCTGCTCCAAACAACAACTCTCTGCGTGGATTTGATGTTATAGACAACATCAAGGCACATATTGAGGGGATCTGTCCGCAGGTGGTCTCATGT
GCTGACATCCTTGCTGTGGCGGCACGCGAATCTGTTGTTGCG
CTAGGAGGTCCTACTTGGGTTGTCCAGCTGGGACGGCGCGACTCAACAACAGCAAGCCTGGATACTGCAAACAATGAC
ATTCCAGCTCCAACCTTTGACCTTGGTGATCTCACGAAGTCTTTTTCAAACAAAGGACTAAGCGCAACTGACATGATTGCACTCTCAG
GGGCTCACACCATAGGCCAGGCAAGGTGCGTC
AATTTTCGCAACCGCATCTACAGTGAGACCAACATCGACACTTCCCTGGCAACATCTCTGAAATCAAATTGTCCAAACACGACTGGCGACAACAACATATCCCCCCTTGATGCATCGACG
CCCTACGCCTTTGACAATTTTTACTACAAGAACCTGCTGAACAAGAAGGGTGTCCTGCATTCTGACCAGCAACTATTCAATGGTGGTTCAGCAGATTCCCAGACGACCACCTACTCATCA
AACATGGCAACATTCTTCACTGATTTCAGCGCAGCAATGGTGAAGATGGGCAACATCAACCCCATTACTGGATCTAGTGGACAGATCAGGAAGAACTGCAGGAAGGTAAACTAG

Retrieve as FASTA