Entry information : EguPrx152
Entry ID 11460
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2012-12-13 (Qiang Li)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-13 (Achraf Jemmat)
Peroxidase information: EguPrx152
Name EguPrx152
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx152
start..stop
S start..stop
EgrPrx152 630 0 1..309 1..309
EglPrx152 627 0 1..309 1..309
EcamPrx152 621 0 1..309 1..309
EguPrx150 609 0 1..309 1..309
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26842..27003 162 N° 2 27250..28014 765  
join(26842..27003,27250..28014)


exon

Literature and cross-references EguPrx152
Protein sequence: EguPrx152
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   309
PWM (Da):   %s   33101.6  
PI (pH):   %s   8.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNSGSATLQVGFYRSACPAAESVVRKAVNKAVARNPGTGAGLIRMHFHDCFVRGCDASILLDSTLGNPSEKEHPANDPSLRGYEVIDKAKAELEHLCPQTVSCDDILAFAARDSTYKLGSINYAVPAGRRDGLVSLRDEPSQNLPPPSLDAQQLEANFARKGLSLDEMVTLSGAHSIGVSHCSSFSNRLYSSNATHKQDPSLEPKLASELKAKCPNNGGTSDPTVPLDFVTANRLDNKYYTNLKKHRGVLTSDQTLFNSPSTAHIVRRNANHGGAWASKFAAAMVKMGSIDVLTGSQGEIRRNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
scaffold_10_34441 (26842..28014)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCAGCAACTCTCCAAGTTGGATTTTACCGCTCCGCTTGCCCGGCTGCAGAGTCTGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCCGGCACTGGC
GCCGGGCTTATTAGAATGCACTTCCACGATTGCTTTGTTCGG
GTATGCAAACACTTCGTACCACATTTCTGAAGTAGCAGTAACAATCTCGATTTCAATAAGCAGTAGCGAGGATAAACT
TTTCCTAGCGAAAGAAGTTATGTTGATATTTTGTTATTACAAAGGATATTAGTTAGATGCGAGTATATTCACCTAGTCCAACATAAAAGTAACTTAATAATCGACGTTCCTTACGCAGAT
GCATTTCAGCAATTCTGATGATGTTCGTATTTTTTGAAAAAATAATAGGGTTGCGATGCATCAATTTTGCTCGATTCAACACTGGGCAACCCATCAGAGAAGGAGCATCCCGCGAACGAC
CCAAGCTTACGAGGCTACGAAGTCATCGACAAGGCGAAGGCCGAGCTAGAGCATCTATGCCCCCAGACGGTCTCTTGTGACGATATTCTGGCATTCGCAGCCCGCGACAGCACCTACAAG
CTGGGCAGCATTAACTACGCAGTCCCGGCTGGTCGCCGCGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTGGATGCTCAACAGTTAGAAGCTAAT
TTTGCAAGGAAAGGTCTCTCTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGATCGGAGTCTCGCACTGTTCCTCCTTCTCGAACCGCTTGTACTCCTCCAACGCCACGCACAAG
CAAGACCCTTCATTGGAACCCAAGTTGGCAAGTGAACTGAAAGCGAAGTGTCCGAACAATGGCGGCACCAGTGACCCGACGGTCCCATTGGACTTTGTCACCGCCAACAGGCTCGACAAC
AAGTACTACACTAATTTAAAGAAACACCGAGGCGTATTGACTTCAGATCAAACGCTTTTTAATAGCCCTTCGACGGCACATATTGTGAGGAGGAACGCTAATCATGGCGGAGCATGGGCT
AGCAAATTTGCAGCTGCAATGGTGAAGATGGGATCAATTGATGTTCTCACCGGGAGCCAGGGCGAGATTAGGAGGAATTGCAGAGTTGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCAGCAACTCTCCAAGTTGGATTTTACCGCTCCGCTTGCCCGGCTGCAGAGTCTGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCCGGCACTGGC
GCCGGGCTTATTAGAATGCACTTCCACGATTGCTTTGTTCGG
GGTTGCGATGCATCAATTTTGCTCGATTCAACACTGGGCAACCCATCAGAGAAGGAGCATCCCGCGAACGACCCAAGC
TTACGAGGCTACGAAGTCATCGACAAGGCGAAGGCCGAGCTAGAGCATCTATGCCCCCAGACGGTCTCTTGTGACGATATTCTGGCATTCGCAGCCCGCGACAGCACCTACAAGCTGGGC
AGCATTAACTACGCAGTCCCGGCTGGTCGCCGCGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTGGATGCTCAACAGTTAGAAGCTAATTTTGCA
AGGAAAGGTCTCTCTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGATCGGAGTCTCGCACTGTTCCTCCTTCTCGAACCGCTTGTACTCCTCCAACGCCACGCACAAGCAAGAC
CCTTCATTGGAACCCAAGTTGGCAAGTGAACTGAAAGCGAAGTGTCCGAACAATGGCGGCACCAGTGACCCGACGGTCCCATTGGACTTTGTCACCGCCAACAGGCTCGACAACAAGTAC
TACACTAATTTAAAGAAACACCGAGGCGTATTGACTTCAGATCAAACGCTTTTTAATAGCCCTTCGACGGCACATATTGTGAGGAGGAACGCTAATCATGGCGGAGCATGGGCTAGCAAA
TTTGCAGCTGCAATGGTGAAGATGGGATCAATTGATGTTCTCACCGGGAGCCAGGGCGAGATTAGGAGGAATTGCAGAGTTGTGAAC

Retrieve as FASTA