Entry information : AtrPrx20
Entry ID 11482
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2016-03-23 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-23 (Achraf Jemmat)
Peroxidase information: AtrPrx20
Name AtrPrx20
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Amborellaceae Amborella
Organism Amborella trichopoda    [TaxId: 13333 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtrPrx20
start..stop
S start..stop
PpePrx21 354 5e-123 18..315 21..321
AtrPrx19 349 3e-121 19..318 6..303
VvPrx82 347 5e-120 1..318 7..325
GmPrx324 337 3e-116 21..318 29..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 471089..471286 198 N° 2 469718..470075 358 N° 3 468794..469194 401  
complement(join(468794..469194,469718..470075,471089..471286))


exon

Literature and cross-references AtrPrx20
DNA ref. GenBank:   KI396296.1 (471286..468794)
Protein sequence: AtrPrx20
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (300)
PWM (Da):   %s   34449.64 (32518.5)  
PI (pH):   %s   5.79 (5.53) Peptide Signal:   %s   cut: 19 range:19-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKLLLFLLVNFLTLGSGGSLSYDFYNTSCPDVEDVVRETLAPIFLTHPTAPAALLRLMFHDCQVQGCDASILLDTDHPRISSEMISSKNFGIKHRESIGIVKEAVESVCPNQVSCADIIVLAARESVAVSGGPYVEVALGRRDSTITDATLADTFLPSANVGVDEALRILTAKGLNLEESVAILGAHTLGATHCVNIINRLYGPKADTGIILDFKMLLQLNCPLGVTLASNATFVANDPTSLAFDNQFYQQILTGKGLLRVDSEMQHSAFTSPLVARFADHQDYFFRVFSSAFLKLSSYQVLTGNHGQIRKWCDRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGCTTTTGCTCTTCCTTTTGGTGAACTTTCTCACTCTAGGCAGTGGGGGCTCTTTGTCTTATGATTTCTACAATACTTCTTGTCCGGATGTGGAAGATGTAGTGAGAGAAACA
TTGGCACCCATCTTTCTCACTCATCCTACTGCTCCTGCAGCTCTACTCAGGCTTATGTTTCATGATTGCCAAGTTCAG
GTAGACCCATCTCTCTCTCTCTCTCTCTCTCTCTGTGTGCCT
GTGTTGCATGTGTGTGTTAATGGCTAAAGTAAAGGAACAATGTTGATTTGCATAGTATCACCAGAGTTCAAATCTCTTCGTCGAGTTTGGAGAAAGAAATTTTCATGAAGTATAAAACAG
TTATACCTACCATATTTAAATGGGTTGTTTCTCTGTCAAGTTTTTGAGTCTTTTTTGTTATCTTTTCTCTATATATAAAGGAAGAAATTTCTTTTGAGAAGGCAGATGCATCAAGCTACA
TAAATGCATAGTTTTGGAAAATGTTAGTTGAATCTAGGCATAAGGAAATATTTGAGCCATTTTATGTTTACCCAACTAGAATGCCATGATCTTCACTTTTTGTTTCATAACTATGGTTAG
TGGCCAAAATATGTCAGTTAGATCACTATGGGTGAAACGGGGGCAAAAACCTTGCTGATTTGTTCCAATCTTGTAAAATCATAAAGTTCATCATTTTCAAAACAATCATGGCATTCTCCT
TATTTTCATCAATGAATATTGTCTTGAATCTTGATTATGTGCATCTTCTAAGTTCTATGCACATGAATTGTATATGCACCAGAGTTTAGTATTACAAATGTCATTGCTCATGCGCGCATA
GCACACTTTGCATGTTCCACACATTCTATGAACACAAGGTAAGAAAATACCCACATATTTATACCACTCAATCCTCACTCTTCTTCAATGTCGGACTAAAATCCACACCTTTCTCTCCCT
CATGGCTACGTGAAACTTAGGTAAACTACAATAAAAGCTCATGTTATTTTGAAATACTTAGAAGTATTTCCCAAAATAAAAATACTAACAACATTTACATCATTAATTATGCATAGTATC
TTTAAAGCATTGAAATTAGCCATAAAAATAGTATTATTAGAAGCAAGTAGTAATAGTATTGTTGTTCTTTCTCTATCAGTTGAAATGGATCCATATCCTTATAACTTTAGAATTACTCTA
AGTCTCCCCAGGGCTGTGATGCATCAATCCTGTTAGACACTGATCACCCTAGAATAAGCTCAGAGATGATCTCTAGCAAGAACTTCGGAATCAAGCATCGTGAATCGATCGGGATCGTAA
AAGAGGCGGTTGAGAGTGTCTGCCCTAACCAAGTGTCATGTGCTGATATTATCGTCCTAGCAGCAAGGGAGTCTGTCGCCGTCTCCGGTGGGCCCTATGTCGAGGTTGCACTAGGCAGAC
GGGACTCGACCATTACAGATGCCACACTTGCCGACACGTTTCTTCCTTCTGCGAATGTTGGCGTAGATGAAGCACTTAGGATCCTAACCGCTAAGGGGTTGAATCTCGAAGAGTCCGTCG
CCATTTTAG
GTAAATTCAAAAATTCAAAAATAACTAATAAAAAAGTAGTTAGACTTGTTCTAACATGCCATTCTCTTGTTATTTGAAAATTTCAATCATAAAAAACCAAAGCTAGGGTTT
GAACGTTGGTTTTAATGATGTGAAATTTCATAAGTACTGATTTATGGTGTTTTGAGTTTTGACAATAAAGTTCCTAAAACTTGCAAACTGAAAAATGTAAAATTTGTTTTCATTTTAAGA
TGATTACATCACTGTAATGAAGTGAAATATTTCATAAGAAGTCTTCTTTTTTTGTCTTTTTTTTGTTCTTTTTGAGAATATCCTTCCCAAAGAGTCTTTTCAAAAGAATAGTGTTTGTCA
TAAATGAGCATCAAGGGAATTTGATCATATCCTCTGCTAGATGGAAGCATAAACTCAGAAGTGGCCCCTTCTTGCAGCTTGCAAGAACTTAGAAATCTCTCTCTCTCTCATTATAACAAT
TGTACAGTACAATTCAACATCTCTCAATGCTGAGCATGTGGAGCTCTTGCAGGTGCACACACTCTAGGAGCCACGCACTGTGTGAACATCATTAACAGATTGTACGGCCCGAAAGCAGAC
ACCGGCATCATCTTAGATTTCAAAATGTTGCTCCAATTGAATTGCCCATTGGGGGTCACATTGGCTAGCAACGCAACCTTCGTGGCTAATGATCCGACGTCCTTAGCCTTCGATAACCAG
TTCTATCAGCAGATTCTTACAGGGAAAGGGTTGCTAAGGGTCGACTCCGAGATGCAGCACAGCGCATTCACATCACCTCTCGTCGCACGATTCGCGGATCACCAAGATTACTTCTTTCGT
GTTTTCTCCTCTGCATTTTTGAAGCTCTCATCTTATCAAGTCTTAACAGGAAACCATGGCCAAATTCGAAAGTGGTGTGATAGAGTAAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGCTTTTGCTCTTCCTTTTGGTGAACTTTCTCACTCTAGGCAGTGGGGGCTCTTTGTCTTATGATTTCTACAATACTTCTTGTCCGGATGTGGAAGATGTAGTGAGAGAAACA
TTGGCACCCATCTTTCTCACTCATCCTACTGCTCCTGCAGCTCTACTCAGGCTTATGTTTCATGATTGCCAAGTTCAG
GGCTGTGATGCATCAATCCTGTTAGACACTGATCACCCTAGA
ATAAGCTCAGAGATGATCTCTAGCAAGAACTTCGGAATCAAGCATCGTGAATCGATCGGGATCGTAAAAGAGGCGGTTGAGAGTGTCTGCCCTAACCAAGTGTCATGTGCTGATATTATC
GTCCTAGCAGCAAGGGAGTCTGTCGCCGTCTCCGGTGGGCCCTATGTCGAGGTTGCACTAGGCAGACGGGACTCGACCATTACAGATGCCACACTTGCCGACACGTTTCTTCCTTCTGCG
AATGTTGGCGTAGATGAAGCACTTAGGATCCTAACCGCTAAGGGGTTGAATCTCGAAGAGTCCGTCGCCATTTTAG
GTGCACACACTCTAGGAGCCACGCACTGTGTGAACATCATTAAC
AGATTGTACGGCCCGAAAGCAGACACCGGCATCATCTTAGATTTCAAAATGTTGCTCCAATTGAATTGCCCATTGGGGGTCACATTGGCTAGCAACGCAACCTTCGTGGCTAATGATCCG
ACGTCCTTAGCCTTCGATAACCAGTTCTATCAGCAGATTCTTACAGGGAAAGGGTTGCTAAGGGTCGACTCCGAGATGCAGCACAGCGCATTCACATCACCTCTCGTCGCACGATTCGCG
GATCACCAAGATTACTTCTTTCGTGTTTTCTCCTCTGCATTTTTGAAGCTCTCATCTTATCAAGTCTTAACAGGAAACCATGGCCAAATTCGAAAGTGGTGTGATAGAGTAAATTGA

Retrieve as FASTA