Entry information : EguPrx31
Entry ID 11498
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2016-02-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: EguPrx31
Name EguPrx31
Class Class III peroxidase    [Orthogroup: Prx042]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx31
start..stop
S start..stop
EgrPrx31 667 0 1..323 1..323
EglPrx31 663 0 1..323 1..323
EcamPrx31 659 0 1..323 1..323
EguPrx28 610 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1204..1431 228 N° 2 1530..1724 195 N° 3 1898..2443 546  
join(1204..1431,1530..1724,1898..2443)


exon

Literature and cross-references EguPrx31
Protein sequence: EguPrx31
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   35159.63 (32611.3)  
PI (pH):   %s   6.24 (5.96) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSLNFFRALLLLFLATSAFSTRPYKEGLTPHFYDYACPQALPAVQRIVEAAVQQERRMGASLLRLHFHDCFVNGCDASILLDPSPTIDSEKLAFPNNNSARGFEVIDQIKAEVDKACGYSLVSCADILAIAARDSVVALGGPSWEVQLGRRDSTRASRTTANTDIPAPNMDLPSLISTFQKQGLDTRDLVALSGAHTIGFAQCRVFRNRTYNDANIAADFAGSLRSLCPRTGEDSNLAGLDPSPAQFDALYFHNLLAQKGLLHSDQALYSGGSTDELVKTYSDDAEAFWDDFAKSMIKMGNIKPLIGNQGQIRLNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
scaffold_1_750 (1204..2443)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGCTTTGTTAAT
GTACGACATGTC
CACAATACTCTTAATTTCGCACTGGTTACTTAGCGGCGCTCNCACANGTCCTAATTTGATTTGTTTCCATTTATGCAATAATGTAGGGTTGCGATGCTTCAATACTTTTGGATCCATCCC
CTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTNATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGTGGATACTCACTCGTATCTTGCG
CAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
GTACATCTAATCTTAATCTCACCTATATTGTGGGTCATTATACCAAGCGTAGACAAGTAAAAGAGTCTTCAGCTAATTG
AACACACTGTATAGCCACAGATACCCATGCATAACATTGCACATANATGAGCAAAGTTCGATGTGAATATAAAAGGTTGACGTTCATATTTCAGCTTGGAGGGCCTTCATGGGAAGTACA
ACTTGGAAGGAGGGACTCGACCAGGGCGAGTAGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACG
GGACTTGGTCGCACTGAGCGGTGCACACACAATTGGGTTCGCGCAATGTCGCGTTTTCAGGAACCGCACGTACAACGATGCCAACATCGCCGCCGATTTCGCTGGGAGCCTCCGGTCCTT
GTGCCCACGTACTGGAGAGGACAGCAACCTCGCTGGTTTGGATCCTTCACCGGCTCAATTTGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGC
GCTTTACAGTGGTGGGTCAACGGATGAGCTTGTGAAAACTTACAGCGATGATGCNGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGG
AAACCAGGGCCAGATTCGCTTGAATTGCCGGAAGGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTAGTAGCCTCAACTTCTTCCGAGCACTGCTCTTATTGTTCCTAGCGACGTCGGCTTTCTCGACGCGCCCTTACAAGGAAGGCCTCACGCCGCACTTCTACGACTACGCTTGT
CCTCAAGCTTTGCCTGCCGTCCAACGCATCGTGGAGGCAGCAGTGCAGCAGGAGCGACGCATGGGCGCTTCCTTACTGCGTTTGCACTTCCACGATTGCTTTGTTAAT
GGTTGCGATGCT
TCAATACTTTTGGATCCATCCCCTACCATTGACAGCGAAAAGCTCGCGTTTCCAAATAACAATTCAGCTAGAGGATTTGAAGTNATCGACCAAATTAAAGCAGAGGTGGACAAAGCTTGT
GGATACTCACTCGTATCTTGCGCAGACATCTTGGCCATCGCAGCTCGTGACTCTGTTGTTGCG
CTTGGAGGGCCTTCATGGGAAGTACAACTTGGAAGGAGGGACTCGACCAGGGCGAGT
AGGACAACGGCCAACACCGACATTCCCGCGCCAAACATGGACTTGCCTTCACTGATCAGCACGTTCCAAAAGCAAGGTCTCGACACACGGGACTTGGTCGCACTGAGCGGTGCACACACA
ATTGGGTTCGCGCAATGTCGCGTTTTCAGGAACCGCACGTACAACGATGCCAACATCGCCGCCGATTTCGCTGGGAGCCTCCGGTCCTTGTGCCCACGTACTGGAGAGGACAGCAACCTC
GCTGGTTTGGATCCTTCACCGGCTCAATTTGACGCATTGTACTTCCACAATCTGTTGGCGCAAAAGGGGCTTCTTCACTCTGATCAGGCGCTTTACAGTGGTGGGTCAACGGATGAGCTT
GTGAAAACTTACAGCGATGATGCNGAGGCCTTTTGGGATGATTTTGCGAAGTCGATGATCAAGATGGGAAACATAAAGCCGTTGATTGGAAACCAGGGCCAGATTCGCTTGAATTGCCGG
AAGGTGAAC

Retrieve as FASTA