Entry information : EguPrx41
Entry ID 11505
Creation 2012-12-05 (Qiang Li)
Last sequence changes 2016-02-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: EguPrx41
Name EguPrx41
Class Class III peroxidase    [Orthogroup: Prx042]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus gunnii    [TaxId: 3933 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EguPrx41
start..stop
S start..stop
EgrPrx41 660 0 1..321 1..321
EgrPrx38 657 0 1..321 1..321
EguPrx38 652 0 1..321 1..321
EgrPrx35 646 0 1..321 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3392..3613 222 N° 2 3734..3928 195 N° 3 4067..4612 546  
join(3392..3613,3734..3928,4067..4612)


exon

Literature and cross-references EguPrx41
Protein sequence: EguPrx41
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (300)
PWM (Da):   %s   35220.94 (33015.7)  
PI (pH):   %s   9.23 (9.23) Peptide Signal:   %s   cut: 22 range:22-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFLTLFQALLILSLAASTLSTRPYKNGLTPYFYDYVCPQALPAIKRVVEGAVQQERRMGASLLRLHFHDCFVNGCDGSILLDSTATIESEKFAAPNNNSARGFEVIDQIKAEVDRVCGRPVVSCADILAVTARDSVVALGGPSWKVRLGRRDSTTASRTTANNDIPAPNMDLPALINNFKRQGLKVKDLVALSGAHTIGFAQCFTFRNRTFNDSNINQAFAKNLRSYCPRTGSDSNLASLDPTPARFDTLYYSNLLTQKGLLHSDQALSTGESALELVKSYSHDYEAFWKDFAKSMVRMGNIKPLTGNQGQIRSNCRRLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
scaffold_1_754 (3392..4612)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCCTCACCCTCTTCCAAGCGCTTCTCATCTTGTCCCTCGCGGCCTCAACTCTTTCAACTCGTCCTTACAAGAATGGCCTCACGCCATACTTCTACGACTACGTTTGCCCTCAA
GCCTTGCCTGCCATCAAGCGCGTCGTTGAGGGGGCGGTGCAGCAAGAGCGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTTCACGACTGTTTCGTCAAT
GTAAGACATATATGTGCC
AGCTAACTTTCACATTAATCTGTTCTCAAAAATANTGATTACTATTCAGCGTAACACAANATTTGCCAACATTGATTTATGTTTGGGTGTCGAATGATGCAGGGTTGTGATGGGTCGATA
CTCTTGGATTCAACCGCAACCATCGAGAGTGAAAAGTTCGCGGCTCCTAATAACAATTCGGCCAGAGGTTTCGAAGTGATCGACCAAATAAAGGCGGAGGTTGACAGAGTATGTGGACGT
CCCGTGGTTTCTTGTGCAGACATCTTGGCTGTCACCGCTCGTGACTCTGTCGTTGCG
GTACGTCTAGTTTTACTGCATCCCGNGATGACCATTAATCAGCAAATCTAAATGGAGACCATC
ATTGGCTTAGTTGATTTTCATGCGCCGTAAGACATTGCCAATCCGAATTAGGTGTTAACTTCTTTCATATTTCAGTTAGGAGGGCCTTCGTGGAAAGTACGACTCGGACGAAGAGATTCG
ACGACGGCGAGCAGGACGACGGCAAACAACGACATCCCTGCNCCGAACATGGACTTACCCGCCTTAATTAACAATTTCAAGAGACAAGGCCTNAAGGTCAAGGACTTGGTCGCGCTGAGC
GGCGCTCACACAATCGGCTTCGCACAGTGCTTTACTTTCAGGAATAGGACATTCAATGACAGCAACATCAACCAGGCATTCGCAAAGAATCTCCGGTCCTACTGCCCGCGCACAGGAAGC
GACTCTAACCTCGCAAGTTTAGATCCCACGCCAGCGCGTTTCGACACATTGTACTACAGTAACTTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTGTCAACTGGTGAATCC
GCACTCGAGCTAGTGAAGAGCTATAGCCACGATTATGAAGCATTTTGGAAGGATTTCGCTAAATCGATGGTCAGGATGGGAAATATCAAGCCACTGACCGGAAACCAAGGTCAAATTCGC
TCGAATTGCCGGAGGTTGAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCCTCACCCTCTTCCAAGCGCTTCTCATCTTGTCCCTCGCGGCCTCAACTCTTTCAACTCGTCCTTACAAGAATGGCCTCACGCCATACTTCTACGACTACGTTTGCCCTCAA
GCCTTGCCTGCCATCAAGCGCGTCGTTGAGGGGGCGGTGCAGCAAGAGCGACGCATGGGCGCTTCCTTGCTGCGCTTGCACTTTCACGACTGTTTCGTCAAT
GGTTGTGATGGGTCGATA
CTCTTGGATTCAACCGCAACCATCGAGAGTGAAAAGTTCGCGGCTCCTAATAACAATTCGGCCAGAGGTTTCGAAGTGATCGACCAAATAAAGGCGGAGGTTGACAGAGTATGTGGACGT
CCCGTGGTTTCTTGTGCAGACATCTTGGCTGTCACCGCTCGTGACTCTGTCGTTGCG
TTAGGAGGGCCTTCGTGGAAAGTACGACTCGGACGAAGAGATTCGACGACGGCGAGCAGGACG
ACGGCAAACAACGACATCCCTGCNCCGAACATGGACTTACCCGCCTTAATTAACAATTTCAAGAGACAAGGCCTNAAGGTCAAGGACTTGGTCGCGCTGAGCGGCGCTCACACAATCGGC
TTCGCACAGTGCTTTACTTTCAGGAATAGGACATTCAATGACAGCAACATCAACCAGGCATTCGCAAAGAATCTCCGGTCCTACTGCCCGCGCACAGGAAGCGACTCTAACCTCGCAAGT
TTAGATCCCACGCCAGCGCGTTTCGACACATTGTACTACAGTAACTTGTTGACCCAGAAGGGCCTTCTTCACTCTGATCAGGCACTGTCAACTGGTGAATCCGCACTCGAGCTAGTGAAG
AGCTATAGCCACGATTATGAAGCATTTTGGAAGGATTTCGCTAAATCGATGGTCAGGATGGGAAATATCAAGCCACTGACCGGAAACCAAGGTCAAATTCGCTCGAATTGCCGGAGGTTG
AAT

Retrieve as FASTA