Entry information : ZmPrx108 (GRMZM2G176085)
Entry ID 1151
Creation 2009-04-14 (Christophe Dunand)
Last sequence changes 2011-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx108 (GRMZM2G176085)
Name (synonym) ZmPrx108 (GRMZM2G176085)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx108
start..stop
S start..stop
ZmPrx108_35A19 622 0 1..328 1..330
SbPrx03 582 0 1..328 1..334
SiPrx160 581 0 1..328 1..326
ZmPrx141 539 0 22..328 26..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6358574..6358987 414 N° 2 6358284..6358449 166 N° 3 6357750..6358156 407  
complement(join(6357750..6358156,6358284..6358449,6358574..6358987))


exon

Literature and cross-references ZmPrx108 (GRMZM2G176085)
Literature Hunter,B.G. et al., unpublished
Protein ref. UniProtKB:   B4FYD8
mRNA ref. GenBank:   BT042126
EST ref. GenBank:   DV020681 [5' end]   DV020680 [3' end]
Cluster/Prediction ref. UniGene:   Zm.30307
Protein sequence: ZmPrx108 (GRMZM2G176085)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328
PWM (Da):   %s   34667.41 Transmb domain:   %s   i7-26o
PI (pH):   %s   6.13
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARPRPSVVVLAVAVAVASLAQPGAADLKQDYYASTCPNVEAIVRGVVQQRLQATIRAVGSTVRLFFHDCFVEGCDGSVLIESTPGNQAEKDASDNKSLASEGFDTVRSAKAAVEAACPDTVSCADVLAIAARDAISMSGGPFFPVELGRLDGLISTASSVPGQLPEANQTMDQLLAVFKAHGLNMSDLVALSAAHSVGLAHCSKFASRLYSYQLPGQPTDPTLNPKYARFLESRCPDGGPDNLVLMDQATPAQFDNQYYRNLQDGGGLLGSDQLLYTDNRTRPMVDSLANSTAAFYRALADAVVRLGRVGVKSGRRGNVRKQCDVFN

Retrieve as FASTA  
Remarks Complete sequence from 4 ESTs and genomic (chromo 5, introns 2 and 3). Strain="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCCTAGGCCGTCGGTCGTCGTCCTCGCGGTGGCCGTCGCCGTGGCGTCCCTCGCGCAGCCCGGCGCGGCCGACCTGAAGCAGGACTACTACGCGAGCACCTGCCCCAACGTG
GAGGCCATCGTGCGCGGCGTGGTGCAGCAGCGACTGCAGGCCACCATCCGGGCCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAGGGTTGCGACGGCTCGGTGCTG
ATCGAATCCACGCCCGGCAACCAGGCCGAGAAGGACGCCTCCGACAACAAGTCCCTCGCGTCCGAAGGCTTCGACACCGTGCGGAGCGCCAAGGCCGCCGTCGAGGCCGCCTGCCCGGAC
ACGGTCTCCTGCGCCGACGTGCTCGCCATCGCCGCTCGGGACGCCATCTCCATG
GTGCATATACATCGTCTAATAACATCTAAGTCACCGTTTTATATGCCTGCACGTTAGCTAGTTCCA
GGCAGCTAGGCACGGGAACACTCTAGAGTAGGAGTATATAACCTATCCTCGCATGCAGAGTGGCGGGCCTTTCTTCCCAGTGGAGCTGGGCAGGCTGGACGGCCTGATCTCCACCGCCAG
CAGCGTGCCAGGCCAGCTTCCCGAGGCCAACCAGACCATGGACCAACTGCTGGCAGTCTTCAAGGCACACGGGCTCAACATGTCCGACCTCGTCGCGCTCTCAG
GTCCGCGTTCGTCGTC
AGACACACAACACACGCATCAACTCTATGCTTTGTGTACTGTATACATGCGTGCGTACGTACGTGAACGGCCATGATCGCTGAAAATGAAATGCTGTCTGTGATGGAGCAGCGGCGCACA
GCGTGGGGCTGGCGCACTGCAGCAAGTTCGCGAGCCGGCTGTACAGCTACCAGCTGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCAAGTACGCGCGGTTCCTGGAGAGCAGGTGCC
CCGACGGCGGGCCCGACAACCTGGTGCTCATGGACCAGGCCACGCCGGCGCAGTTCGACAACCAGTACTACCGCAACCTCCAGGACGGCGGCGGGCTGCTGGGCTCCGACCAGCTGCTCT
ACACCGACAACCGGACGCGCCCCATGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCTACCGCGCCTTAGCCGACGCCGTCGTCCGGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGC
GGGGCAACGTCCGCAAGCAGTGCGACGTGTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCCTAGGCCGTCGGTCGTCGTCCTCGCGGTGGCCGTCGCCGTGGCGTCCCTCGCGCAGCCCGGCGCGGCCGACCTGAAGCAGGACTACTACGCGAGCACCTGCCCCAACGTG
GAGGCCATCGTGCGCGGCGTGGTGCAGCAGCGACTGCAGGCCACCATCCGGGCCGTCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAGGGTTGCGACGGCTCGGTGCTG
ATCGAATCCACGCCCGGCAACCAGGCCGAGAAGGACGCCTCCGACAACAAGTCCCTCGCGTCCGAAGGCTTCGACACCGTGCGGAGCGCCAAGGCCGCCGTCGAGGCCGCCTGCCCGGAC
ACGGTCTCCTGCGCCGACGTGCTCGCCATCGCCGCTCGGGACGCCATCTCCATG
AGTGGCGGGCCTTTCTTCCCAGTGGAGCTGGGCAGGCTGGACGGCCTGATCTCCACCGCCAGCAGC
GTGCCAGGCCAGCTTCCCGAGGCCAACCAGACCATGGACCAACTGCTGGCAGTCTTCAAGGCACACGGGCTCAACATGTCCGACCTCGTCGCGCTCTCAG
CGGCGCACAGCGTGGGGCTG
GCGCACTGCAGCAAGTTCGCGAGCCGGCTGTACAGCTACCAGCTGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCAAGTACGCGCGGTTCCTGGAGAGCAGGTGCCCCGACGGCGGG
CCCGACAACCTGGTGCTCATGGACCAGGCCACGCCGGCGCAGTTCGACAACCAGTACTACCGCAACCTCCAGGACGGCGGCGGGCTGCTGGGCTCCGACCAGCTGCTCTACACCGACAAC
CGGACGCGCCCCATGGTGGACTCGCTGGCCAACAGCACCGCCGCCTTCTACCGCGCCTTAGCCGACGCCGTCGTCCGGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCGGGGCAACGTC
CGCAAGCAGTGCGACGTGTTCAACTGA

Retrieve as FASTA